EMAIL THIS PAGE TO A FRIEND

SRCIN1

SRC kinase signaling inhibitor 1

Synonyms: P140 SNIP
UniProtKB ID: Q9C0H9, Q75T46, Q8N4W8
Gene ID:
Mouse(56013) SRC kinase signaling inhibitor 1
Rat(56029) SRC kinase signaling inhibitor 1
cow(535629) SRC kinase signaling inhibitor 1
sheep(101102076) SRC kinase signaling inhibitor 1
naked mole-rat(101723888) SRC kinase signaling inhibitor 1
domestic guinea pig(100725186) SRC kinase signaling inhibitor 1
chicken(426281) SRC kinase signaling inhibitor 1
chicken(101666553) SRC kinase signaling inhibitor 1
dog(491037) SRC kinase signaling inhibitor 1
domestic cat(101099340) SRC kinase signaling inhibitor 1
chicken(101751151) SRC kinase signaling inhibitor 1
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025248 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025248 Rosetta Predictions human pricing
NM_019378 Rosetta Predictions rat pricing
NM_018873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182473 predicted 2448
2 SASI_Hs01_00182474 predicted 696
3 SASI_Hs01_00182475 predicted 3718
4 SASI_Hs01_00182476 predicted 2401
5 SASI_Hs01_00182477 predicted 3426
6 SASI_Hs01_00182478 predicted 973
7 SASI_Hs01_00182479 predicted 3639
8 SASI_Hs01_00182480 predicted 3715
9 SASI_Hs01_00182482 predicted 624
10 SASI_Hs02_00358081 predicted 899
11 SASI_Hs01_00182481 predicted 2436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090463 predicted 3430
2 SASI_Rn01_00090464 predicted 3729
3 SASI_Rn01_00090465 predicted 3597
4 SASI_Rn01_00090466 predicted 552
5 SASI_Rn01_00090467 predicted 2400
6 SASI_Rn01_00090468 predicted 3724
7 SASI_Rn01_00090469 predicted 2168
8 SASI_Rn01_00090470 predicted 2819
9 SASI_Rn01_00090471 predicted 543
10 SASI_Rn01_00090472 predicted 3693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020924 predicted 559
2 SASI_Mm02_00324259 predicted 2383
3 SASI_Mm02_00324260 predicted 2436
4 SASI_Mm01_00020926 predicted 3617
5 SASI_Mm01_00020927 predicted 1972
6 SASI_Mm02_00324261 predicted 931
7 SASI_Mm02_00324262 predicted 1656
8 SASI_Mm02_00324263 predicted 2475
9 SASI_Mm02_00324264 predicted 1608
10 SASI_Mm02_00324265 predicted 969
11 SASI_Mm01_00020922 predicted 1003
12 SASI_Mm01_00020923 predicted 2480
13 SASI_Mm01_00020925 predicted 2421
14 SASI_Mm01_00020928 predicted 3489
15 SASI_Mm01_00020929 predicted 2043
16 SASI_Mm01_00020930 predicted 3664
17 SASI_Mm01_00020931 predicted 825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018873
SRCIN1 MISSION shRNA Bacterial Glycerol Stock
SRC kinase signaling inhibitor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-3741s1c1
Sequence:CCGGCCATCCCTGTATTGACTTCCTCTCGAGAGGAAGTCAATACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-997s1c1
Sequence:CCGGCCGAAGTATCATTAAGATCTACTCGAGTAGATCTTAATGATACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-3337s1c1
Sequence:CCGGGAAAGACTCAGTCTTCATCAACTCGAGTTGATGAAGACTGAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-2932s1c1
Sequence:CCGGCAGCAAGAGAAACACGGACAACTCGAGTTGTCCGTGTTTCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-2789s1c1
Sequence:CCGGGCTGAAACCGACTTCAGCAAACTCGAGTTTGCTGAAGTCGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-991s1c1
Sequence:CCGGCCAAGACCGAAGTATCATTAACTCGAGTTAATGATACTTCGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018873.1-4168s1c1
Sequence:CCGGCCCAAGAACACTTGGAACAAACTCGAGTTTGTTCCAAGTGTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018873.2-5493s1c1
Sequence:CCGGGACCTCACAATGATGCAATTACTCGAGTAATTGCATCATTGTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018873
SRCIN1 MISSION shRNA shRNA Plasmid DNA
SRC kinase signaling inhibitor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-3741s1c1
Sequence:CCGGCCATCCCTGTATTGACTTCCTCTCGAGAGGAAGTCAATACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-997s1c1
Sequence:CCGGCCGAAGTATCATTAAGATCTACTCGAGTAGATCTTAATGATACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-3337s1c1
Sequence:CCGGGAAAGACTCAGTCTTCATCAACTCGAGTTGATGAAGACTGAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-2932s1c1
Sequence:CCGGCAGCAAGAGAAACACGGACAACTCGAGTTGTCCGTGTTTCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-2789s1c1
Sequence:CCGGGCTGAAACCGACTTCAGCAAACTCGAGTTTGCTGAAGTCGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-991s1c1
Sequence:CCGGCCAAGACCGAAGTATCATTAACTCGAGTTAATGATACTTCGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018873.1-4168s1c1
Sequence:CCGGCCCAAGAACACTTGGAACAAACTCGAGTTTGTTCCAAGTGTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018873.2-5493s1c1
Sequence:CCGGGACCTCACAATGATGCAATTACTCGAGTAATTGCATCATTGTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018873
SRCIN1 MISSION shRNA Lentiviral Transduction Particles
SRC kinase signaling inhibitor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-3741s1c1
Sequence:CCGGCCATCCCTGTATTGACTTCCTCTCGAGAGGAAGTCAATACAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-997s1c1
Sequence:CCGGCCGAAGTATCATTAAGATCTACTCGAGTAGATCTTAATGATACTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018873.1-3337s1c1
Sequence:CCGGGAAAGACTCAGTCTTCATCAACTCGAGTTGATGAAGACTGAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-2932s1c1
Sequence:CCGGCAGCAAGAGAAACACGGACAACTCGAGTTGTCCGTGTTTCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-2789s1c1
Sequence:CCGGGCTGAAACCGACTTCAGCAAACTCGAGTTTGCTGAAGTCGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018873.1-991s1c1
Sequence:CCGGCCAAGACCGAAGTATCATTAACTCGAGTTAATGATACTTCGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018873.1-4168s1c1
Sequence:CCGGCCCAAGAACACTTGGAACAAACTCGAGTTTGTTCCAAGTGTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216728    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018873.2-5493s1c1
Sequence:CCGGGACCTCACAATGATGCAATTACTCGAGTAATTGCATCATTGTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025248
SRCIN1 MISSION shRNA Bacterial Glycerol Stock
SRC kinase signaling inhibitor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2784s1c1
Sequence:CCGGCTTCAACAAGAGCGTGGACTTCTCGAGAAGTCCACGCTCTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3639s1c1
Sequence:CCGGGCAGGCCACTAAACCATCTAACTCGAGTTAGATGGTTTAGTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-546s1c1
Sequence:CCGGGCAGCCAAACTACTGGAGTTTCTCGAGAAACTCCAGTAGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-980s1c1
Sequence:CCGGGCAGTATTATCAAGATCTACACTCGAGTGTAGATCTTGATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3717s1c1
Sequence:CCGGCAGAACCTCTATCCCTGTATTCTCGAGAATACAGGGATAGAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2929s1c1
Sequence:CCGGGTGGACAAAGCTGTGTCTGTTCTCGAGAACAGACACAGCTTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2778s1c1
Sequence:CCGGGACTGACTTCAACAAGAGCGTCTCGAGACGCTCTTGTTGAAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3716s1c1
Sequence:CCGGCCAGAACCTCTATCCCTGTATCTCGAGATACAGGGATAGAGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025248
SRCIN1 MISSION shRNA shRNA Plasmid DNA
SRC kinase signaling inhibitor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2784s1c1
Sequence:CCGGCTTCAACAAGAGCGTGGACTTCTCGAGAAGTCCACGCTCTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3639s1c1
Sequence:CCGGGCAGGCCACTAAACCATCTAACTCGAGTTAGATGGTTTAGTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-546s1c1
Sequence:CCGGGCAGCCAAACTACTGGAGTTTCTCGAGAAACTCCAGTAGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-980s1c1
Sequence:CCGGGCAGTATTATCAAGATCTACACTCGAGTGTAGATCTTGATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3717s1c1
Sequence:CCGGCAGAACCTCTATCCCTGTATTCTCGAGAATACAGGGATAGAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2929s1c1
Sequence:CCGGGTGGACAAAGCTGTGTCTGTTCTCGAGAACAGACACAGCTTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2778s1c1
Sequence:CCGGGACTGACTTCAACAAGAGCGTCTCGAGACGCTCTTGTTGAAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3716s1c1
Sequence:CCGGCCAGAACCTCTATCCCTGTATCTCGAGATACAGGGATAGAGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025248
SRCIN1 MISSION shRNA Lentiviral Transduction Particles
SRC kinase signaling inhibitor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2784s1c1
Sequence:CCGGCTTCAACAAGAGCGTGGACTTCTCGAGAAGTCCACGCTCTTGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3639s1c1
Sequence:CCGGGCAGGCCACTAAACCATCTAACTCGAGTTAGATGGTTTAGTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-546s1c1
Sequence:CCGGGCAGCCAAACTACTGGAGTTTCTCGAGAAACTCCAGTAGTTTGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-980s1c1
Sequence:CCGGGCAGTATTATCAAGATCTACACTCGAGTGTAGATCTTGATAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3717s1c1
Sequence:CCGGCAGAACCTCTATCCCTGTATTCTCGAGAATACAGGGATAGAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2929s1c1
Sequence:CCGGGTGGACAAAGCTGTGTCTGTTCTCGAGAACAGACACAGCTTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-2778s1c1
Sequence:CCGGGACTGACTTCAACAAGAGCGTCTCGAGACGCTCTTGTTGAAGTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025248.1-3716s1c1
Sequence:CCGGCCAGAACCTCTATCCCTGTATCTCGAGATACAGGGATAGAGGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks