EMAIL THIS PAGE TO A FRIEND

SRCRB4D

scavenger receptor cysteine rich domain containing, group B (4 domains)

Synonyms: S4D-SRCRB SRCRB-S4D SSC4D
UniProtKB ID: Q8WTU2, Q2HIZ5, Q6ZMG3, Q96BF5
Gene ID:
Human(136853) Summary: The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins, some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern.[supplied by OMIM, Apr 2004]
Mouse(109267) scavenger receptor cysteine rich domain containing, group B (4 domains)
Rat(304401) scavenger receptor cysteine rich domain containing, group B (4 domains)
chicken(771260) scavenger receptor cysteine rich domain containing, group B (4 domains)
domestic cat(101091673) scavenger receptor cysteine rich domain containing, group B (4 domains)
Horse(100060975) scavenger receptor cysteine rich domain containing, group B (4 domains)
dog(608018) scavenger receptor cysteine rich domain containing, group B (4 domains)
domestic guinea pig(100729639) scavenger receptor cysteine rich domain containing, group B (4 domains)
naked mole-rat(101716783) scavenger receptor cysteine rich domain containing, group B (4 domains)
Domestic Rabbit(100354025) scavenger receptor cysteine rich domain containing, group B (4 domains)
cow(539182) scavenger receptor cysteine rich domain containing, group B (4 domains)
sheep(101116277) scavenger receptor cysteine rich domain containing, group B (4 domains)
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080744 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080744 Rosetta Predictions human pricing
XM_001077242 Rosetta Predictions rat pricing
XM_222076 Rosetta Predictions rat pricing
XM_355648 Rosetta Predictions mouse pricing
XM_916633 Rosetta Predictions mouse pricing
XM_980357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120592 predicted 1271
2 SASI_Hs01_00120593 predicted 2013
3 SASI_Hs02_00362542 predicted 1826
4 SASI_Hs01_00120595 predicted 2345
5 SASI_Hs01_00120596 predicted 2278
6 SASI_Hs01_00120597 predicted 930
7 SASI_Hs01_00120598 predicted 2191
8 SASI_Hs01_00120599 predicted 2279
9 SASI_Hs01_00120600 predicted 1754
10 SASI_Hs01_00120601 predicted 2274
11 SASI_Hs01_00120594 predicted 2407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356323 predicted 1996
2 SASI_Rn02_00356324 predicted 1551
3 SASI_Rn02_00356325 predicted 458
4 SASI_Rn02_00356326 predicted 1184
5 SASI_Rn02_00356327 predicted 1659
6 SASI_Rn02_00356328 predicted 2071
7 SASI_Rn02_00356329 predicted 1536
8 SASI_Rn02_00356330 predicted 1468
9 SASI_Rn02_00356331 predicted 1787
10 SASI_Rn02_00356332 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380552 predicted 530
2 SASI_Rn02_00380553 predicted 490
3 SASI_Rn02_00380554 predicted 457
4 SASI_Rn02_00380555 predicted 465
5 SASI_Rn02_00380556 predicted 486
6 SASI_Rn02_00380557 predicted 609
7 SASI_Rn02_00380558 predicted 494
8 SASI_Rn02_00380559 predicted 293
9 SASI_Rn02_00380560 predicted 358
10 SASI_Rn02_00380561 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425835 predicted 756
2 SASI_Mm02_00425836 predicted 817
3 SASI_Mm02_00425837 predicted 778
4 SASI_Mm02_00425838 predicted 914
5 SASI_Mm01_00226664 predicted 832
6 SASI_Mm02_00425839 predicted 913
7 SASI_Mm02_00425840 predicted 309
8 SASI_Mm02_00425841 predicted 787
9 SASI_Mm02_00425842 predicted 759
10 SASI_Mm02_00425843 predicted 992
11 SASI_Mm01_00226660 predicted 1844
12 SASI_Mm01_00226661 predicted 2248
13 SASI_Mm01_00226662 predicted 2201
14 SASI_Mm01_00226663 predicted 2299
15 SASI_Mm01_00226665 predicted 1968
16 SASI_Mm01_00226666 predicted 2063
17 SASI_Mm01_00226667 predicted 1955
18 SASI_Mm01_00226668 predicted 1778
19 SASI_Mm01_00226669 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440454 predicted 1840
2 SASI_Mm02_00440455 predicted 2242
3 SASI_Mm02_00440456 predicted 2198
4 SASI_Mm02_00440457 predicted 2284
5 SASI_Mm02_00440458 predicted 825
6 SASI_Mm02_00440459 predicted 1970
7 SASI_Mm02_00440460 predicted 2055
8 SASI_Mm02_00440461 predicted 1949
9 SASI_Mm02_00440462 predicted 1775
10 SASI_Mm02_00440463 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204837 predicted 395
2 SASI_Mm01_00204838 predicted 344
3 SASI_Mm01_00204839 predicted 336
4 SASI_Mm01_00204840 predicted 292
5 SASI_Mm01_00204841 predicted 392
6 SASI_Mm01_00204842 predicted 343
7 SASI_Mm01_00204843 predicted 339
8 SASI_Mm01_00204844 predicted 288
9 SASI_Mm01_00204845 predicted 352
10 SASI_Mm01_00204846 predicted 293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080744
SRCRB4D MISSION shRNA Bacterial Glycerol Stock
scavenger receptor cysteine rich domain containing, group B (4 domains)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080744.1-2344s21c1
Sequence:CCGGGGGAAGAGGATGATTCCTAACCTCGAGGTTAGGAATCATCCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080744.1-2279s21c1
Sequence:CCGGTCGACTGTTGTGAGCCCAATTCTCGAGAATTGGGCTCACAACAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080744.1-851s21c1
Sequence:CCGGGGAAGATGTTAACCAGTAGAGCTCGAGCTCTACTGGTTAACATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080744.1-1760s21c1
Sequence:CCGGGGCATCTACGTCTGGTCAATGCTCGAGCATTGACCAGACGTAGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-780s1c1
Sequence:CCGGCCACAATTGCTTTCACTACGACTCGAGTCGTAGTGAAAGCAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-447s1c1
Sequence:CCGGCCAAGCCCTGTCTTTCCTTCTCTCGAGAGAAGGAAAGACAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-874s1c1
Sequence:CCGGCCTCCTACGACACTGCCGAATCTCGAGATTCGGCAGTGTCGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-2002s1c1
Sequence:CCGGTGCTCTCATATCCGCTGGGATCTCGAGATCCCAGCGGATATGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-1453s1c1
Sequence:CCGGTGCGACGATGACTGGGACTTTCTCGAGAAAGTCCCAGTCATCGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080744
SRCRB4D MISSION shRNA shRNA Plasmid DNA
scavenger receptor cysteine rich domain containing, group B (4 domains)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080744.1-2344s21c1
Sequence:CCGGGGGAAGAGGATGATTCCTAACCTCGAGGTTAGGAATCATCCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080744.1-2279s21c1
Sequence:CCGGTCGACTGTTGTGAGCCCAATTCTCGAGAATTGGGCTCACAACAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080744.1-851s21c1
Sequence:CCGGGGAAGATGTTAACCAGTAGAGCTCGAGCTCTACTGGTTAACATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080744.1-1760s21c1
Sequence:CCGGGGCATCTACGTCTGGTCAATGCTCGAGCATTGACCAGACGTAGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-780s1c1
Sequence:CCGGCCACAATTGCTTTCACTACGACTCGAGTCGTAGTGAAAGCAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-447s1c1
Sequence:CCGGCCAAGCCCTGTCTTTCCTTCTCTCGAGAGAAGGAAAGACAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-874s1c1
Sequence:CCGGCCTCCTACGACACTGCCGAATCTCGAGATTCGGCAGTGTCGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-2002s1c1
Sequence:CCGGTGCTCTCATATCCGCTGGGATCTCGAGATCCCAGCGGATATGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-1453s1c1
Sequence:CCGGTGCGACGATGACTGGGACTTTCTCGAGAAAGTCCCAGTCATCGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080744
SRCRB4D MISSION shRNA Lentiviral Transduction Particles
scavenger receptor cysteine rich domain containing, group B (4 domains)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080744.1-2344s21c1
Sequence:CCGGGGGAAGAGGATGATTCCTAACCTCGAGGTTAGGAATCATCCTCTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080744.1-2279s21c1
Sequence:CCGGTCGACTGTTGTGAGCCCAATTCTCGAGAATTGGGCTCACAACAGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080744.1-851s21c1
Sequence:CCGGGGAAGATGTTAACCAGTAGAGCTCGAGCTCTACTGGTTAACATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080744.1-1760s21c1
Sequence:CCGGGGCATCTACGTCTGGTCAATGCTCGAGCATTGACCAGACGTAGATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-780s1c1
Sequence:CCGGCCACAATTGCTTTCACTACGACTCGAGTCGTAGTGAAAGCAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-447s1c1
Sequence:CCGGCCAAGCCCTGTCTTTCCTTCTCTCGAGAGAAGGAAAGACAGGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-874s1c1
Sequence:CCGGCCTCCTACGACACTGCCGAATCTCGAGATTCGGCAGTGTCGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-2002s1c1
Sequence:CCGGTGCTCTCATATCCGCTGGGATCTCGAGATCCCAGCGGATATGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080744.1-1453s1c1
Sequence:CCGGTGCGACGATGACTGGGACTTTCTCGAGAAAGTCCCAGTCATCGTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355648
SRCRB4D MISSION shRNA Bacterial Glycerol Stock
scavenger receptor cysteine rich domain containing, group B (4 domains)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355648.3-1965s1c1
Sequence:CCGGGCTGTCTGTAAATGCCTTCAACTCGAGTTGAAGGCATTTACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-272s1c1
Sequence:CCGGCACAACTGCTTTCACTATGAACTCGAGTTCATAGTGAAAGCAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-1560s1c1
Sequence:CCGGCCTTGCTACTGTGCTCTCATACTCGAGTATGAGAGCACAGTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-1161s1c1
Sequence:CCGGCGCTTTGTGCAGTGATTGGTACTCGAGTACCAATCACTGCACAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-596s1c1
Sequence:CCGGCTGGACAATGTTCACTGCGAACTCGAGTTCGCAGTGAACATTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355648
SRCRB4D MISSION shRNA shRNA Plasmid DNA
scavenger receptor cysteine rich domain containing, group B (4 domains)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355648.3-1965s1c1
Sequence:CCGGGCTGTCTGTAAATGCCTTCAACTCGAGTTGAAGGCATTTACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-272s1c1
Sequence:CCGGCACAACTGCTTTCACTATGAACTCGAGTTCATAGTGAAAGCAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-1560s1c1
Sequence:CCGGCCTTGCTACTGTGCTCTCATACTCGAGTATGAGAGCACAGTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-1161s1c1
Sequence:CCGGCGCTTTGTGCAGTGATTGGTACTCGAGTACCAATCACTGCACAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-596s1c1
Sequence:CCGGCTGGACAATGTTCACTGCGAACTCGAGTTCGCAGTGAACATTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355648
SRCRB4D MISSION shRNA Lentiviral Transduction Particles
scavenger receptor cysteine rich domain containing, group B (4 domains)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355648.3-1965s1c1
Sequence:CCGGGCTGTCTGTAAATGCCTTCAACTCGAGTTGAAGGCATTTACAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-272s1c1
Sequence:CCGGCACAACTGCTTTCACTATGAACTCGAGTTCATAGTGAAAGCAGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-1560s1c1
Sequence:CCGGCCTTGCTACTGTGCTCTCATACTCGAGTATGAGAGCACAGTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-1161s1c1
Sequence:CCGGCGCTTTGTGCAGTGATTGGTACTCGAGTACCAATCACTGCACAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355648.3-596s1c1
Sequence:CCGGCTGGACAATGTTCACTGCGAACTCGAGTTCGCAGTGAACATTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks