EMAIL THIS PAGE TO A FRIEND

SRD5A1

steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)

Synonyms: S5AR 1
UniProtKB ID: P18405, B2R7Q1, Q9UHY4, Q9UP36, Q9UP37
Gene ID:
Human(6715) Summary: Steroid 5-alpha-reductase (EC 1.3.99.5) catalyzes the conversion of testosterone into the more potent androgen, dihydrotestosterone (DHT). Also see SRD5A2 (MIM 607306).[supplied by OMIM, Mar 2008]
Mouse(78925) steroid 5 alpha-reductase 1
Rat(24950) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
Zebrafish(767715) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
chicken(770453) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
dog(403716) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
domestic cat(101098848) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
cow(614612) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
sheep(100642181) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
domestic guinea pig(100735979) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
naked mole-rat(101714960) steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001047 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159371 MISSION® esiRNA esiRNA human SRD5A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001047 Rosetta Predictions human pricing
NM_017070 Rosetta Predictions rat pricing
NM_175283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011648 predicted 763
2 SASI_Hs01_00011649 predicted 586
3 SASI_Hs01_00011650 predicted 446
4 SASI_Hs01_00011651 predicted 658
5 SASI_Hs01_00011652 predicted 474
6 SASI_Hs01_00011653 predicted 518
7 SASI_Hs01_00011654 predicted 542
8 SASI_Hs02_00311486 predicted 563
9 SASI_Hs01_00011656 predicted 264
10 SASI_Hs01_00011657 predicted 654
11 SASI_Hs01_00011655 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108426 predicted 614
2 SASI_Rn01_00108427 predicted 551
3 SASI_Rn01_00108428 predicted 512
4 SASI_Rn01_00108429 predicted 514
5 SASI_Rn01_00108430 predicted 525
6 SASI_Rn02_00261273 predicted 589
7 SASI_Rn01_00108432 predicted 1377
8 SASI_Rn01_00108433 predicted 1408
9 SASI_Rn01_00108434 predicted 588
10 SASI_Rn01_00108435 predicted 651
11 SASI_Rn01_00108431 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177634 predicted 767
2 SASI_Mm01_00177635 predicted 1273
3 SASI_Mm01_00177636 predicted 676
4 SASI_Mm01_00177637 predicted 780
5 SASI_Mm01_00177638 predicted 1063
6 SASI_Mm01_00177639 predicted 460
7 SASI_Mm01_00177640 predicted 1175
8 SASI_Mm01_00177641 predicted 489
9 SASI_Mm01_00177642 predicted 579
10 SASI_Mm01_00177643 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175283
VALIDATED
SRD5A1 MISSION shRNA Bacterial Glycerol Stock
steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-456s1c1
Sequence:CCGGCTTCCTGTTCTGCACCTTAAACTCGAGTTTAAGGTGCAGAACAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175283.2-700s1c1
Sequence:CCGGACTGAAAGTTTACATCGTGAACTCGAGTTCACGATGTAAACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-150s1c1
Sequence:CCGGCCTGGAGGGTTTCCTGGCTTTCTCGAGAAAGCCAGGAAACCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175283.2-490s1c1
Sequence:CCGGAGCCGATACTTGAGCCAGTTTCTCGAGAAACTGGCTCAAGTATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-354s1c1
Sequence:CCGGCCTGCTAGCTATGTTTCTGATCTCGAGATCAGAAACATAGCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175283.3-1282s21c1
Sequence:CCGGACGTTCCTCCTTCACAGATACCTCGAGGTATCTGTGAAGGAGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175283.3-1447s21c1
Sequence:CCGGGAGGTGAGACTGCACAGTATCCTCGAGGATACTGTGCAGTCTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175283.3-783s21c1
Sequence:CCGGTGTATCTTCAGCCAACTATTTCTCGAGAAATAGTTGGCTGAAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175283.3-488s21c1
Sequence:CCGGACGTGCAAAGGACGCTGGTTTCTCGAGAAACCAGCGTCCTTTGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175283
VALIDATED
SRD5A1 MISSION shRNA shRNA Plasmid DNA
steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-456s1c1
Sequence:CCGGCTTCCTGTTCTGCACCTTAAACTCGAGTTTAAGGTGCAGAACAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175283.2-700s1c1
Sequence:CCGGACTGAAAGTTTACATCGTGAACTCGAGTTCACGATGTAAACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-150s1c1
Sequence:CCGGCCTGGAGGGTTTCCTGGCTTTCTCGAGAAAGCCAGGAAACCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175283.2-490s1c1
Sequence:CCGGAGCCGATACTTGAGCCAGTTTCTCGAGAAACTGGCTCAAGTATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-354s1c1
Sequence:CCGGCCTGCTAGCTATGTTTCTGATCTCGAGATCAGAAACATAGCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175283.3-1282s21c1
Sequence:CCGGACGTTCCTCCTTCACAGATACCTCGAGGTATCTGTGAAGGAGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175283.3-1447s21c1
Sequence:CCGGGAGGTGAGACTGCACAGTATCCTCGAGGATACTGTGCAGTCTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175283.3-783s21c1
Sequence:CCGGTGTATCTTCAGCCAACTATTTCTCGAGAAATAGTTGGCTGAAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175283.3-488s21c1
Sequence:CCGGACGTGCAAAGGACGCTGGTTTCTCGAGAAACCAGCGTCCTTTGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175283
VALIDATED
SRD5A1 MISSION shRNA Lentiviral Transduction Particles
steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-456s1c1
Sequence:CCGGCTTCCTGTTCTGCACCTTAAACTCGAGTTTAAGGTGCAGAACAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175283.2-700s1c1
Sequence:CCGGACTGAAAGTTTACATCGTGAACTCGAGTTCACGATGTAAACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-150s1c1
Sequence:CCGGCCTGGAGGGTTTCCTGGCTTTCTCGAGAAAGCCAGGAAACCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175283.2-490s1c1
Sequence:CCGGAGCCGATACTTGAGCCAGTTTCTCGAGAAACTGGCTCAAGTATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175283.2-354s1c1
Sequence:CCGGCCTGCTAGCTATGTTTCTGATCTCGAGATCAGAAACATAGCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175283.3-1282s21c1
Sequence:CCGGACGTTCCTCCTTCACAGATACCTCGAGGTATCTGTGAAGGAGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175283.3-1447s21c1
Sequence:CCGGGAGGTGAGACTGCACAGTATCCTCGAGGATACTGTGCAGTCTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175283.3-783s21c1
Sequence:CCGGTGTATCTTCAGCCAACTATTTCTCGAGAAATAGTTGGCTGAAGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175283.3-488s21c1
Sequence:CCGGACGTGCAAAGGACGCTGGTTTCTCGAGAAACCAGCGTCCTTTGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001047
VALIDATED
SRD5A1 MISSION shRNA Bacterial Glycerol Stock
steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001047.1-419s1c1
Sequence:CCGGCGGTGCTTAATTTACCCGTTTCTCGAGAAACGGGTAAATTAAGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-659s1c1
Sequence:CCGGCCAGGAGATACTGGATACAAACTCGAGTTTGTATCCAGTATCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-508s1c1
Sequence:CCGGCGGCTATTTGCAAAGCAGATACTCGAGTATCTGCTTTGCAAATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-690s1c1
Sequence:CCGGGAGGCTTATTTGAATACGTAACTCGAGTTACGTATTCAAATAAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001047.1-847s1c1
Sequence:CCGGCCTCCGGAAATTTGAAGAGTACTCGAGTACTCTTCAAATTTCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-688s21c1
Sequence:GTACCGGCCATTCAGATCATATCCTAAGCTCGAGCTTAGGATATGATCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-472s21c1
Sequence:CCGGCTACGGGCATCGGTGCTTAATCTCGAGATTAAGCACCGATGCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001047.2-1199s21c1
Sequence:CCGGGGGTAATAACTGCTGATATTTCTCGAGAAATATCAGCAGTTATTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-559s21c1
Sequence:CCGGCTGTACCTGTAACGGCTATTTCTCGAGAAATAGCCGTTACAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-536s21c1
Sequence:CCGGGCGTGTACAATGGCGATTATGCTCGAGCATAATCGCCATTGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001047
VALIDATED
SRD5A1 MISSION shRNA shRNA Plasmid DNA
steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001047.1-419s1c1
Sequence:CCGGCGGTGCTTAATTTACCCGTTTCTCGAGAAACGGGTAAATTAAGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-659s1c1
Sequence:CCGGCCAGGAGATACTGGATACAAACTCGAGTTTGTATCCAGTATCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-508s1c1
Sequence:CCGGCGGCTATTTGCAAAGCAGATACTCGAGTATCTGCTTTGCAAATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-690s1c1
Sequence:CCGGGAGGCTTATTTGAATACGTAACTCGAGTTACGTATTCAAATAAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001047.1-847s1c1
Sequence:CCGGCCTCCGGAAATTTGAAGAGTACTCGAGTACTCTTCAAATTTCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-688s21c1
Sequence:GTACCGGCCATTCAGATCATATCCTAAGCTCGAGCTTAGGATATGATCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-472s21c1
Sequence:CCGGCTACGGGCATCGGTGCTTAATCTCGAGATTAAGCACCGATGCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001047.2-1199s21c1
Sequence:CCGGGGGTAATAACTGCTGATATTTCTCGAGAAATATCAGCAGTTATTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-559s21c1
Sequence:CCGGCTGTACCTGTAACGGCTATTTCTCGAGAAATAGCCGTTACAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-536s21c1
Sequence:CCGGGCGTGTACAATGGCGATTATGCTCGAGCATAATCGCCATTGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001047
VALIDATED
SRD5A1 MISSION shRNA Lentiviral Transduction Particles
steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001047.1-419s1c1
Sequence:CCGGCGGTGCTTAATTTACCCGTTTCTCGAGAAACGGGTAAATTAAGCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-659s1c1
Sequence:CCGGCCAGGAGATACTGGATACAAACTCGAGTTTGTATCCAGTATCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-508s1c1
Sequence:CCGGCGGCTATTTGCAAAGCAGATACTCGAGTATCTGCTTTGCAAATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001047.1-690s1c1
Sequence:CCGGGAGGCTTATTTGAATACGTAACTCGAGTTACGTATTCAAATAAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001047.1-847s1c1
Sequence:CCGGCCTCCGGAAATTTGAAGAGTACTCGAGTACTCTTCAAATTTCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-688s21c1
Sequence:GTACCGGCCATTCAGATCATATCCTAAGCTCGAGCTTAGGATATGATCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-472s21c1
Sequence:CCGGCTACGGGCATCGGTGCTTAATCTCGAGATTAAGCACCGATGCCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001047.2-1199s21c1
Sequence:CCGGGGGTAATAACTGCTGATATTTCTCGAGAAATATCAGCAGTTATTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-559s21c1
Sequence:CCGGCTGTACCTGTAACGGCTATTTCTCGAGAAATAGCCGTTACAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001047.2-536s21c1
Sequence:CCGGGCGTGTACAATGGCGATTATGCTCGAGCATAATCGCCATTGTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks