EMAIL THIS PAGE TO A FRIEND

SRD5A2

steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)

UniProtKB ID: P31213, B2RE87, Q2M1R4, Q9BYE6
Gene ID:
Human(6716) Summary: This gene encodes a microsomal protein expressed at high levels in androgen-sensitive tissues such as the prostate. The encoded protein is active at acidic pH and is sensitive to the 4-azasteroid inhibitor finasteride. Deficiencies in this gene can result in male pseudohermaphroditism, specifically pseudovaginal perineoscrotal hypospadias (PPSH). [provided by RefSeq, Jul 2008]
Mouse(94224) steroid 5 alpha-reductase 2
Rat(64677) steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
chicken(772291) steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
dog(403715) steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
domestic cat(101086898) steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
naked mole-rat(101708836) steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
domestic guinea pig(100731664) steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
cow(527024) steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
sheep(100820756) steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000348 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031361 MISSION® esiRNA esiRNA human SRD5A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000348 Rosetta Predictions human pricing
NM_022711 Rosetta Predictions rat pricing
NM_053188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038009 predicted 924
2 SASI_Hs01_00038010 predicted 643
3 SASI_Hs01_00038011 predicted 386
4 SASI_Hs02_00302383 predicted 759
5 SASI_Hs01_00038012 predicted 378
6 SASI_Hs01_00038013 predicted 912
7 SASI_Hs01_00038014 predicted 497
8 SASI_Hs01_00038015 predicted 496
9 SASI_Hs01_00038016 predicted 721
10 SASI_Hs01_00038017 predicted 371
11 SASI_Hs01_00038018 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057235 predicted 733
2 SASI_Rn01_00057236 predicted 846
3 SASI_Rn01_00057237 predicted 502
4 SASI_Rn01_00057238 predicted 413
5 SASI_Rn01_00057239 predicted 604
6 SASI_Rn01_00057240 predicted 985
7 SASI_Rn02_00263538 predicted 840
8 SASI_Rn01_00057241 predicted 1046
9 SASI_Rn01_00057242 predicted 918
10 SASI_Rn01_00057243 predicted 954
11 SASI_Rn01_00057244 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337749 predicted 398
2 SASI_Mm02_00337750 predicted 398
3 SASI_Mm02_00337751 predicted 494
4 SASI_Mm02_00337752 predicted 502
5 SASI_Mm02_00337753 predicted 619
6 SASI_Mm02_00337754 predicted 629
7 SASI_Mm02_00337755 predicted 476
8 SASI_Mm02_00337756 predicted 630
9 SASI_Mm02_00337757 predicted 516
10 SASI_Mm02_00337758 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000348
SRD5A2 MISSION shRNA Bacterial Glycerol Stock
steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000348.3-984s21c1
Sequence:CCGGGTGGTGTCTGCTTAGAGTTTACTCGAGTAAACTCTAAGCAGACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000348.3-372s21c1
Sequence:CCGGCTCAATCGAGGGAGGCCTTATCTCGAGATAAGGCCTCCCTCGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-334s1c1
Sequence:CCGGGCCTACATTACTTCCACAGGACTCGAGTCCTGTGGAAGTAATGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-761s1c1
Sequence:CCGGCCACCATAGGTTCTACCTCAACTCGAGTTGAGGTAGAACCTATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-458s1c1
Sequence:CCGGTCTGATTTACTGTGCTGAATACTCGAGTATTCAGCACAGTAAATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-631s1c1
Sequence:CCGGCGTATGTTTCTGGAGCCAATTCTCGAGAATTGGCTCCAGAAACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-776s1c1
Sequence:CCGGCCTCAAGATGTTTGAGGACTACTCGAGTAGTCCTCAAACATCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000348
SRD5A2 MISSION shRNA shRNA Plasmid DNA
steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000348.3-984s21c1
Sequence:CCGGGTGGTGTCTGCTTAGAGTTTACTCGAGTAAACTCTAAGCAGACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000348.3-372s21c1
Sequence:CCGGCTCAATCGAGGGAGGCCTTATCTCGAGATAAGGCCTCCCTCGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-334s1c1
Sequence:CCGGGCCTACATTACTTCCACAGGACTCGAGTCCTGTGGAAGTAATGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-761s1c1
Sequence:CCGGCCACCATAGGTTCTACCTCAACTCGAGTTGAGGTAGAACCTATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-458s1c1
Sequence:CCGGTCTGATTTACTGTGCTGAATACTCGAGTATTCAGCACAGTAAATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-631s1c1
Sequence:CCGGCGTATGTTTCTGGAGCCAATTCTCGAGAATTGGCTCCAGAAACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-776s1c1
Sequence:CCGGCCTCAAGATGTTTGAGGACTACTCGAGTAGTCCTCAAACATCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000348
SRD5A2 MISSION shRNA Lentiviral Transduction Particles
steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000348.3-984s21c1
Sequence:CCGGGTGGTGTCTGCTTAGAGTTTACTCGAGTAAACTCTAAGCAGACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000348.3-372s21c1
Sequence:CCGGCTCAATCGAGGGAGGCCTTATCTCGAGATAAGGCCTCCCTCGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-334s1c1
Sequence:CCGGGCCTACATTACTTCCACAGGACTCGAGTCCTGTGGAAGTAATGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-761s1c1
Sequence:CCGGCCACCATAGGTTCTACCTCAACTCGAGTTGAGGTAGAACCTATGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-458s1c1
Sequence:CCGGTCTGATTTACTGTGCTGAATACTCGAGTATTCAGCACAGTAAATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-631s1c1
Sequence:CCGGCGTATGTTTCTGGAGCCAATTCTCGAGAATTGGCTCCAGAAACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000348.2-776s1c1
Sequence:CCGGCCTCAAGATGTTTGAGGACTACTCGAGTAGTCCTCAAACATCTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053188
SRD5A2 MISSION shRNA Bacterial Glycerol Stock
steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-476s1c1
Sequence:CCGGCCTGGTTTATTGCGCGGAATACTCGAGTATTCCGCGCAATAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-530s1c1
Sequence:CCGGCGTCGGTGTCTTCTTCTTTATCTCGAGATAAAGAAGAAGACACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-404s1c1
Sequence:CCGGGCCTTTATCAGCGGTGATCTTCTCGAGAAGATCACCGCTGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-464s1c1
Sequence:CCGGGCAAGCCTACTACCTGGTTTACTCGAGTAAACCAGGTAGTAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-663s1c1
Sequence:CCGGGCCAATTTCCTGGGCGAGATTCTCGAGAATCTCGCCCAGGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053188
SRD5A2 MISSION shRNA shRNA Plasmid DNA
steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-476s1c1
Sequence:CCGGCCTGGTTTATTGCGCGGAATACTCGAGTATTCCGCGCAATAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-530s1c1
Sequence:CCGGCGTCGGTGTCTTCTTCTTTATCTCGAGATAAAGAAGAAGACACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-404s1c1
Sequence:CCGGGCCTTTATCAGCGGTGATCTTCTCGAGAAGATCACCGCTGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-464s1c1
Sequence:CCGGGCAAGCCTACTACCTGGTTTACTCGAGTAAACCAGGTAGTAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-663s1c1
Sequence:CCGGGCCAATTTCCTGGGCGAGATTCTCGAGAATCTCGCCCAGGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053188
SRD5A2 MISSION shRNA Lentiviral Transduction Particles
steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-476s1c1
Sequence:CCGGCCTGGTTTATTGCGCGGAATACTCGAGTATTCCGCGCAATAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-530s1c1
Sequence:CCGGCGTCGGTGTCTTCTTCTTTATCTCGAGATAAAGAAGAAGACACCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-404s1c1
Sequence:CCGGGCCTTTATCAGCGGTGATCTTCTCGAGAAGATCACCGCTGATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-464s1c1
Sequence:CCGGGCAAGCCTACTACCTGGTTTACTCGAGTAAACCAGGTAGTAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053188.1-663s1c1
Sequence:CCGGGCCAATTTCCTGGGCGAGATTCTCGAGAATCTCGCCCAGGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks