EMAIL THIS PAGE TO A FRIEND

SRD5A3

steroid 5 alpha-reductase 3

Synonyms: CDG1P CDG1Q KRIZI SRD5A2L SRD5A2L1
UniProtKB ID: Q9H8P0, Q4W5Q6
Gene ID:
Human(79644) Summary: The protein encoded by this gene belongs to the steroid 5-alpha reductase family, and polyprenol reductase subfamily. It is involved in the production of androgen 5-alpha-dihydrotestosterone (DHT) from testosterone, and maintenance of the androgen-androgen receptor activation pathway. This protein is also necessary for the conversion of polyprenol into dolichol, which is required for the synthesis of dolichol-linked monosaccharides and the oligosaccharide precursor used for N-linked glycosylation of proteins. Mutations in this gene are associated with congenital disorder of glycosylation type Iq. [provided by RefSeq, Mar 2011]
Mouse(57357) steroid 5 alpha-reductase 3
Rat(305291) steroid 5 alpha-reductase 3
Zebrafish(560717) steroid 5 alpha-reductase 3
domestic cat(101090010) steroid 5 alpha-reductase 3
dog(482155) steroid 5 alpha-reductase 3
chicken(422750) steroid 5 alpha-reductase 3
cow(535834) steroid 5 alpha-reductase 3
sheep(101106772) steroid 5 alpha-reductase 3
domestic guinea pig(100727041) steroid 5 alpha-reductase 3
naked mole-rat(101726767) steroid 5 alpha-reductase 3
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108719 Anti-SRD5A3 affinity isolated antibody rabbit, guinea pig, pig, horse, human, canine, canine, yeast, mouse, rat
western blot pricing
HPA027006 Anti-SRD5A3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2102296 Anti-SRD5A3 antibody produced in rabbit affinity isolated antibody rat, human, guinea pig, mouse, horse, canine, bovine, rabbit
western blot pricing
SAB1305468 ANTI-SRD5A3(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024592 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024592 Rosetta Predictions human pricing
NM_001013990 Rosetta Predictions rat pricing
NM_020611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042962 predicted 744
2 SASI_Hs01_00042963 predicted 1023
3 SASI_Hs01_00042964 predicted 729
4 SASI_Hs01_00042965 predicted 794
5 SASI_Hs01_00042967 predicted 817
6 SASI_Hs01_00042968 predicted 927
7 SASI_Hs01_00042969 predicted 757
8 SASI_Hs01_00042970 predicted 1145
9 SASI_Hs02_00356927 predicted 1000
10 SASI_Hs02_00356928 predicted 358
11 SASI_Hs01_00042966 predicted 910
12 SASI_Hs01_00042971 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030764 predicted 530
2 SASI_Rn01_00030765 predicted 778
3 SASI_Rn01_00030767 predicted 710
4 SASI_Rn01_00030768 predicted 421
5 SASI_Rn02_00201344 predicted 591
6 SASI_Rn01_00030769 predicted 899
7 SASI_Rn01_00030770 predicted 580
8 SASI_Rn01_00030771 predicted 383
9 SASI_Rn01_00030772 predicted 881
10 SASI_Rn01_00030773 predicted 547
11 SASI_Rn01_00030766 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120539 predicted 464
2 SASI_Mm01_00120540 predicted 1128
3 SASI_Mm02_00325725 predicted 889
4 SASI_Mm01_00120535 predicted 615
5 SASI_Mm01_00120536 predicted 570
6 SASI_Mm01_00120542 predicted 1008
7 SASI_Mm01_00120544 predicted 563
8 SASI_Mm02_00325726 predicted 625
9 SASI_Mm02_00325727 predicted 358
10 SASI_Mm02_00325728 predicted 1000
11 SASI_Mm01_00120537 predicted 561
12 SASI_Mm01_00120538 predicted 628
13 SASI_Mm01_00120541 predicted 287
14 SASI_Mm01_00120543 predicted 825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020611
VALIDATED
SRD5A3 MISSION shRNA Bacterial Glycerol Stock
steroid 5 alpha-reductase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-1005s1c1
Sequence:CCGGCCCAAAGCATAGGAAAGCGTTCTCGAGAACGCTTTCCTATGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-831s1c1
Sequence:CCGGCGAGTACGTGTCTTCAGCTAACTCGAGTTAGCTGAAGACACGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020611.3-324s1c1
Sequence:CCGGCTGGCTACTTTCTCAGTCGTTCTCGAGAACGACTGAGAAAGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020611.3-735s1c1
Sequence:CCGGTCAGTATAAATGCCACGTCATCTCGAGATGACGTGGCATTTATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-291s1c1
Sequence:CCGGCGTCATCTCAGTTGTGTGGAACTCGAGTTCCACACAACTGAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020611
VALIDATED
SRD5A3 MISSION shRNA shRNA Plasmid DNA
steroid 5 alpha-reductase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-1005s1c1
Sequence:CCGGCCCAAAGCATAGGAAAGCGTTCTCGAGAACGCTTTCCTATGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-831s1c1
Sequence:CCGGCGAGTACGTGTCTTCAGCTAACTCGAGTTAGCTGAAGACACGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020611.3-324s1c1
Sequence:CCGGCTGGCTACTTTCTCAGTCGTTCTCGAGAACGACTGAGAAAGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020611.3-735s1c1
Sequence:CCGGTCAGTATAAATGCCACGTCATCTCGAGATGACGTGGCATTTATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-291s1c1
Sequence:CCGGCGTCATCTCAGTTGTGTGGAACTCGAGTTCCACACAACTGAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020611
VALIDATED
SRD5A3 MISSION shRNA Lentiviral Transduction Particles
steroid 5 alpha-reductase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-1005s1c1
Sequence:CCGGCCCAAAGCATAGGAAAGCGTTCTCGAGAACGCTTTCCTATGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-831s1c1
Sequence:CCGGCGAGTACGTGTCTTCAGCTAACTCGAGTTAGCTGAAGACACGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020611.3-324s1c1
Sequence:CCGGCTGGCTACTTTCTCAGTCGTTCTCGAGAACGACTGAGAAAGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020611.3-735s1c1
Sequence:CCGGTCAGTATAAATGCCACGTCATCTCGAGATGACGTGGCATTTATACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020611.3-291s1c1
Sequence:CCGGCGTCATCTCAGTTGTGTGGAACTCGAGTTCCACACAACTGAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024592
VALIDATED
SRD5A3 MISSION shRNA Bacterial Glycerol Stock
steroid 5 alpha-reductase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024592.1-1123s1c1
Sequence:CCGGCCCAAAGTACAGTTTCAGCAACTCGAGTTGCTGAAACTGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024592.1-869s1c1
Sequence:CCGGCAGAGCTGATGATCTACGTTTCTCGAGAAACGTAGATCATCAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024592.1-510s1c1
Sequence:CCGGGCACAGCTTACGAAGACTCTTCTCGAGAAGAGTCTTCGTAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024592.3-479s21c1
Sequence:CCGGTGCATTCTTAGTGCTAGTATTCTCGAGAATACTAGCACTAAGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024592.3-744s21c1
Sequence:CCGGCAGTATAAGTGCCATGTTATTCTCGAGAATAACATGGCACTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024592.3-1463s21c1
Sequence:CCGGCTAGTAGGAATGGACTATATACTCGAGTATATAGTCCATTCCTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024592.3-807s21c1
Sequence:CCGGTGTAACCACAGGATCCCATTTCTCGAGAAATGGGATCCTGTGGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024592
VALIDATED
SRD5A3 MISSION shRNA shRNA Plasmid DNA
steroid 5 alpha-reductase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024592.1-1123s1c1
Sequence:CCGGCCCAAAGTACAGTTTCAGCAACTCGAGTTGCTGAAACTGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024592.1-869s1c1
Sequence:CCGGCAGAGCTGATGATCTACGTTTCTCGAGAAACGTAGATCATCAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024592.1-510s1c1
Sequence:CCGGGCACAGCTTACGAAGACTCTTCTCGAGAAGAGTCTTCGTAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024592.3-479s21c1
Sequence:CCGGTGCATTCTTAGTGCTAGTATTCTCGAGAATACTAGCACTAAGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024592.3-744s21c1
Sequence:CCGGCAGTATAAGTGCCATGTTATTCTCGAGAATAACATGGCACTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024592.3-1463s21c1
Sequence:CCGGCTAGTAGGAATGGACTATATACTCGAGTATATAGTCCATTCCTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024592.3-807s21c1
Sequence:CCGGTGTAACCACAGGATCCCATTTCTCGAGAAATGGGATCCTGTGGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024592
VALIDATED
SRD5A3 MISSION shRNA Lentiviral Transduction Particles
steroid 5 alpha-reductase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024592.1-1123s1c1
Sequence:CCGGCCCAAAGTACAGTTTCAGCAACTCGAGTTGCTGAAACTGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024592.1-869s1c1
Sequence:CCGGCAGAGCTGATGATCTACGTTTCTCGAGAAACGTAGATCATCAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024592.1-510s1c1
Sequence:CCGGGCACAGCTTACGAAGACTCTTCTCGAGAAGAGTCTTCGTAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024592.3-479s21c1
Sequence:CCGGTGCATTCTTAGTGCTAGTATTCTCGAGAATACTAGCACTAAGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024592.3-744s21c1
Sequence:CCGGCAGTATAAGTGCCATGTTATTCTCGAGAATAACATGGCACTTATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024592.3-1463s21c1
Sequence:CCGGCTAGTAGGAATGGACTATATACTCGAGTATATAGTCCATTCCTACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024592.3-807s21c1
Sequence:CCGGTGTAACCACAGGATCCCATTTCTCGAGAAATGGGATCCTGTGGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks