EMAIL THIS PAGE TO A FRIEND

SREBF1

sterol regulatory element binding transcription factor 1

Synonyms: SREBP-1c SREBP1 bHLHd1
Gene ID:
Human(6720) Summary: This gene encodes a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a decamer flanking the low density lipoprotein receptor gene and some genes involved in sterol biosynthesis. The protein is synthesized as a precursor that is attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit the cleavage of the precursor, and the mature nuclear form is rapidly catabolized, thereby reducing transcription. The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20787) sterol regulatory element binding transcription factor 1
Rat(78968) sterol regulatory element binding transcription factor 1
Zebrafish(793274) sterol regulatory element binding transcription factor 1
dog(403475) sterol regulatory element binding transcription factor 1
domestic cat(101087535) sterol regulatory element binding transcription factor 1
Horse(100052283) sterol regulatory element binding transcription factor 1
chicken(373915) sterol regulatory element binding transcription factor 1
naked mole-rat(101705277) sterol regulatory element binding transcription factor 1
domestic guinea pig(100731641) sterol regulatory element binding transcription factor 1
cow(539361) sterol regulatory element binding transcription factor 1
sheep(100329218) sterol regulatory element binding transcription factor 1
Goat(100860908) sterol regulatory element binding transcription factor 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504729 Anti-phospho-SREBP-1 (pSer439) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301449 Anti-phospho-SREBP-1 (pSer439) antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV37145 Anti-SREBF1 (AB1) antibody produced in rabbit affinity isolated antibody mouse, rat
western blot pricing
SAB1412393 ANTI-SREBF1 antibody produced in mouse clone 4G4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA043343 Anti-SREBF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA043878 Anti-SREBF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2102992 Anti-SREBF1, (N-terminal) antibody produced in rabbit affinity isolated antibody pig, guinea pig, horse, mouse, rat, rabbit, human, bovine
western blot pricing
SAB4502850 Anti-SREBP-1 antibody produced in rabbit affinity isolated antibody rat, human
immunohistochemistry, western blot pricing
WH0006720M1 Monoclonal Anti-SREBF1 antibody produced in mouse clone 4B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404405 Monoclonal Anti-SREBF1 antibody produced in mouse clone 4C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005291 Rosetta Predictions human pricing
NM_004176 Rosetta Predictions human pricing
XM_001075680 Rosetta Predictions rat pricing
XM_213329 Rosetta Predictions rat pricing
NM_011480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051828 predicted 1174
2 SASI_Hs01_00051829 predicted 2017
3 SASI_Hs01_00051830 predicted 3777
4 SASI_Hs01_00051831 predicted 1416
5 SASI_Hs01_00051832 predicted 1828
6 SASI_Hs01_00051833 predicted 1371
7 SASI_Hs01_00051834 predicted 1456
8 SASI_Hs01_00051835 predicted 2700
9 SASI_Hs01_00051836 predicted 957
10 SASI_Hs01_00051837 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138754 predicted 1086
2 SASI_Hs01_00138755 predicted 1926
3 SASI_Hs01_00138756 predicted 3688
4 SASI_Hs01_00138757 predicted 1328
5 SASI_Hs01_00138758 predicted 1737
6 SASI_Hs01_00138759 predicted 1282
7 SASI_Hs01_00138760 predicted 1368
8 SASI_Hs01_00138761 predicted 2612
9 SASI_Hs01_00138762 predicted 871
10 SASI_Hs01_00138763 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350695 predicted 1254
2 SASI_Rn02_00350696 predicted 1232
3 SASI_Rn02_00350697 predicted 2110
4 SASI_Rn02_00350698 predicted 724
5 SASI_Rn02_00350699 predicted 2481
6 SASI_Rn02_00350700 predicted 784
7 SASI_Rn02_00350701 predicted 2495
8 SASI_Rn02_00350702 predicted 2669
9 SASI_Rn02_00350703 predicted 1180
10 SASI_Rn02_00350704 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374529 predicted 1254
2 SASI_Rn02_00374530 predicted 1237
3 SASI_Rn02_00374531 predicted 2112
4 SASI_Rn02_00374532 predicted 725
5 SASI_Rn02_00374533 predicted 2482
6 SASI_Rn02_00374534 predicted 791
7 SASI_Rn02_00374535 predicted 2494
8 SASI_Rn02_00374536 predicted 2671
9 SASI_Rn02_00374537 predicted 1186
10 SASI_Rn02_00374538 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135484 predicted 2878
2 SASI_Mm01_00135485 predicted 2519
3 SASI_Mm01_00135486 predicted 2530
4 SASI_Mm01_00135487 predicted 2530
5 SASI_Mm01_00135488 predicted 1003
6 SASI_Mm01_00135489 predicted 2464
7 SASI_Mm01_00135490 predicted 1211
8 SASI_Mm02_00320750 predicted 1089
9 SASI_Mm01_00135492 predicted 1572
10 SASI_Mm02_00320751 predicted 921
11 SASI_Mm01_00135483 predicted 2708
12 SASI_Mm01_00135491 predicted 2106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004176
SREBF1 MISSION shRNA Bacterial Glycerol Stock
sterol regulatory element binding transcription factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-2605s21c1
Sequence:CCGGTATTCCGGGAACATCTCTTAGCTCGAGCTAAGAGATGTTCCCGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-316s21c1
Sequence:CCGGGTGACTTCCCTGGCCTATTTGCTCGAGCAAATAGGCCAGGGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004176.4-4093s21c1
Sequence:CCGGTGAGGCTCCTGTGCTACTTTGCTCGAGCAAAGTAGCACAGGAGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004176.4-4062s21c1
Sequence:CCGGAGTGTAGGTCAGCGTGCTTAGCTCGAGCTAAGCACGCTGACCTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-284s21c1
Sequence:CCGGAGACATGCTTCAGCTTATCAACTCGAGTTGATAAGCTGAAGCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004176.2-3937s1c1
Sequence:CCGGCCCTGTGCTGACGGAAGCCAACTCGAGTTGGCTTCCGTCAGCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1234s1c1
Sequence:CCGGGCTGAATAAATCTGCTGTCTTCTCGAGAAGACAGCAGATTTATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-2734s1c1
Sequence:CCGGCTTCTCCATCAGTTCCAGCATCTCGAGATGCTGGAACTGATGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1297s1c1
Sequence:CCGGCCAGAAACTCAAGCAGGAGAACTCGAGTTCTCCTGCTTGAGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1262s1c1
Sequence:CCGGGCCATCGACTACATTCGCTTTCTCGAGAAAGCGAATGTAGTCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004176
SREBF1 MISSION shRNA shRNA Plasmid DNA
sterol regulatory element binding transcription factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-2605s21c1
Sequence:CCGGTATTCCGGGAACATCTCTTAGCTCGAGCTAAGAGATGTTCCCGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-316s21c1
Sequence:CCGGGTGACTTCCCTGGCCTATTTGCTCGAGCAAATAGGCCAGGGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004176.4-4093s21c1
Sequence:CCGGTGAGGCTCCTGTGCTACTTTGCTCGAGCAAAGTAGCACAGGAGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004176.4-4062s21c1
Sequence:CCGGAGTGTAGGTCAGCGTGCTTAGCTCGAGCTAAGCACGCTGACCTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-284s21c1
Sequence:CCGGAGACATGCTTCAGCTTATCAACTCGAGTTGATAAGCTGAAGCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004176.2-3937s1c1
Sequence:CCGGCCCTGTGCTGACGGAAGCCAACTCGAGTTGGCTTCCGTCAGCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1234s1c1
Sequence:CCGGGCTGAATAAATCTGCTGTCTTCTCGAGAAGACAGCAGATTTATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-2734s1c1
Sequence:CCGGCTTCTCCATCAGTTCCAGCATCTCGAGATGCTGGAACTGATGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1297s1c1
Sequence:CCGGCCAGAAACTCAAGCAGGAGAACTCGAGTTCTCCTGCTTGAGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1262s1c1
Sequence:CCGGGCCATCGACTACATTCGCTTTCTCGAGAAAGCGAATGTAGTCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004176
SREBF1 MISSION shRNA Lentiviral Transduction Particles
sterol regulatory element binding transcription factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-2605s21c1
Sequence:CCGGTATTCCGGGAACATCTCTTAGCTCGAGCTAAGAGATGTTCCCGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-316s21c1
Sequence:CCGGGTGACTTCCCTGGCCTATTTGCTCGAGCAAATAGGCCAGGGAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422088    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004176.4-4093s21c1
Sequence:CCGGTGAGGCTCCTGTGCTACTTTGCTCGAGCAAAGTAGCACAGGAGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004176.4-4062s21c1
Sequence:CCGGAGTGTAGGTCAGCGTGCTTAGCTCGAGCTAAGCACGCTGACCTACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004176.4-284s21c1
Sequence:CCGGAGACATGCTTCAGCTTATCAACTCGAGTTGATAAGCTGAAGCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004176.2-3937s1c1
Sequence:CCGGCCCTGTGCTGACGGAAGCCAACTCGAGTTGGCTTCCGTCAGCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1234s1c1
Sequence:CCGGGCTGAATAAATCTGCTGTCTTCTCGAGAAGACAGCAGATTTATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-2734s1c1
Sequence:CCGGCTTCTCCATCAGTTCCAGCATCTCGAGATGCTGGAACTGATGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1297s1c1
Sequence:CCGGCCAGAAACTCAAGCAGGAGAACTCGAGTTCTCCTGCTTGAGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004176.2-1262s1c1
Sequence:CCGGGCCATCGACTACATTCGCTTTCTCGAGAAAGCGAATGTAGTCGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011480
VALIDATED
SREBF1 MISSION shRNA Bacterial Glycerol Stock
sterol regulatory element binding transcription factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011480.3-2033s21c1
Sequence:CCGGGCGGCTGTTGTCTACCATAAGCTCGAGCTTATGGTAGACAACAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011480.3-3828s21c1
Sequence:CCGGCTCAGCTGATTGCTATCTTTCCTCGAGGAAAGATAGCAATCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011480.3-3879s21c1
Sequence:CCGGCATCTGTTGTAAGGTGTATTTCTCGAGAAATACACCTTACAACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-2228s1c1
Sequence:CCGGCCTGCACTTCTTGACACGTTTCTCGAGAAACGTGTCAAGAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-3110s1c1
Sequence:CCGGGCCTGCTATGAGGAGGGTATTCTCGAGAATACCCTCCTCATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011480.1-1142s1c1
Sequence:CCGGCATCGACTACATCCGCTTCTTCTCGAGAAGAAGCGGATGTAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-1904s1c1
Sequence:CCGGCAGTCTGCTTTGGAACCTCATCTCGAGATGAGGTTCCAAAGCAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-1497s1c1
Sequence:CCGGGCCCTGTGTGTACTGGCCTTTCTCGAGAAAGGCCAGTACACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011480
VALIDATED
SREBF1 MISSION shRNA shRNA Plasmid DNA
sterol regulatory element binding transcription factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011480.3-2033s21c1
Sequence:CCGGGCGGCTGTTGTCTACCATAAGCTCGAGCTTATGGTAGACAACAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011480.3-3828s21c1
Sequence:CCGGCTCAGCTGATTGCTATCTTTCCTCGAGGAAAGATAGCAATCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011480.3-3879s21c1
Sequence:CCGGCATCTGTTGTAAGGTGTATTTCTCGAGAAATACACCTTACAACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-2228s1c1
Sequence:CCGGCCTGCACTTCTTGACACGTTTCTCGAGAAACGTGTCAAGAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-3110s1c1
Sequence:CCGGGCCTGCTATGAGGAGGGTATTCTCGAGAATACCCTCCTCATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011480.1-1142s1c1
Sequence:CCGGCATCGACTACATCCGCTTCTTCTCGAGAAGAAGCGGATGTAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-1904s1c1
Sequence:CCGGCAGTCTGCTTTGGAACCTCATCTCGAGATGAGGTTCCAAAGCAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-1497s1c1
Sequence:CCGGGCCCTGTGTGTACTGGCCTTTCTCGAGAAAGGCCAGTACACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011480
VALIDATED
SREBF1 MISSION shRNA Lentiviral Transduction Particles
sterol regulatory element binding transcription factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011480.3-2033s21c1
Sequence:CCGGGCGGCTGTTGTCTACCATAAGCTCGAGCTTATGGTAGACAACAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011480.3-3828s21c1
Sequence:CCGGCTCAGCTGATTGCTATCTTTCCTCGAGGAAAGATAGCAATCAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011480.3-3879s21c1
Sequence:CCGGCATCTGTTGTAAGGTGTATTTCTCGAGAAATACACCTTACAACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-2228s1c1
Sequence:CCGGCCTGCACTTCTTGACACGTTTCTCGAGAAACGTGTCAAGAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-3110s1c1
Sequence:CCGGGCCTGCTATGAGGAGGGTATTCTCGAGAATACCCTCCTCATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011480.1-1142s1c1
Sequence:CCGGCATCGACTACATCCGCTTCTTCTCGAGAAGAAGCGGATGTAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-1904s1c1
Sequence:CCGGCAGTCTGCTTTGGAACCTCATCTCGAGATGAGGTTCCAAAGCAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011480.1-1497s1c1
Sequence:CCGGGCCCTGTGTGTACTGGCCTTTCTCGAGAAAGGCCAGTACACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks