EMAIL THIS PAGE TO A FRIEND

SREBF2

sterol regulatory element binding transcription factor 2

Synonyms: SREBP-2 SREBP2 bHLHd2
UniProtKB ID: Q12772, Q6GTH7, Q86V36, Q9UH04
Gene ID:
Human(6721) Summary: This gene encodes a member of the a ubiquitously expressed transcription factor that controls cholesterol homeostasis by regulating transcription of sterol-regulated genes. The encoded protein contains a basic helix-loop-helix-leucine zipper (bHLH-Zip) domain and binds the sterol regulatory element 1 motif. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(20788) sterol regulatory element binding factor 2
Rat(300095) sterol regulatory element binding transcription factor 2
cow(507102) sterol regulatory element binding transcription factor 2
sheep(101104393) sterol regulatory element binding transcription factor 2
domestic guinea pig(100718400) sterol regulatory element binding transcription factor 2
naked mole-rat(101701239) sterol regulatory element binding transcription factor 2
Zebrafish(100037309) sterol regulatory element binding transcription factor 2
domestic cat(101082503) sterol regulatory element binding transcription factor 2
Horse(100070704) sterol regulatory element binding transcription factor 2
dog(481228) sterol regulatory element binding transcription factor 2
chicken(395304) sterol regulatory element binding transcription factor 2
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004599 Rosetta Predictions human pricing
NM_001033694 Rosetta Predictions rat pricing
NM_033218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075424 predicted 1798
2 SASI_Hs01_00075425 predicted 2977
3 SASI_Hs01_00075426 predicted 2124
4 SASI_Hs01_00075427 predicted 1895
5 SASI_Hs01_00075428 predicted 1531
6 SASI_Hs01_00075429 predicted 1185
7 SASI_Hs02_00337970 predicted 1769
8 SASI_Hs01_00075431 predicted 1725
9 SASI_Hs01_00075432 predicted 2649
10 SASI_Hs01_00075433 predicted 2596
11 SASI_Hs01_00075430 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075955 predicted 396
2 SASI_Rn01_00075956 predicted 1748
3 SASI_Rn01_00075957 predicted 2974
4 SASI_Rn01_00075958 predicted 1111
5 SASI_Rn01_00075960 predicted 2666
6 SASI_Rn01_00075961 predicted 700
7 SASI_Rn01_00075962 predicted 2994
8 SASI_Rn01_00075963 predicted 746
9 SASI_Rn02_00203714 predicted 1018
10 SASI_Rn01_00075964 predicted 1663
11 SASI_Rn01_00075959 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020952 predicted 1213
2 SASI_Mm01_00020953 predicted 2650
3 SASI_Mm02_00337316 predicted 2235
4 SASI_Mm01_00020955 predicted 2913
5 SASI_Mm01_00020956 predicted 1372
6 SASI_Mm01_00020957 predicted 2652
7 SASI_Mm01_00020958 predicted 1024
8 SASI_Mm01_00020959 predicted 2578
9 SASI_Mm01_00020960 predicted 856
10 SASI_Mm01_00020961 predicted 2575
11 SASI_Mm01_00020954 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004599
VALIDATED
SREBF2 MISSION shRNA Bacterial Glycerol Stock
sterol regulatory element binding transcription factor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-1533s1c1
Sequence:CCGGGCCCTCTATTGGATGATGCAACTCGAGTTGCATCATCCAATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-604s1c1
Sequence:CCGGGCAACAACAGACGGTAATGATCTCGAGATCATTACCGTCTGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004599.2-1421s1c1
Sequence:CCGGGACCTGAAGATCGAGGACTTTCTCGAGAAAGTCCTCGATCTTCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004599.2-3895s1c1
Sequence:CCGGCCTGAGTTTCTCTCTCCTGAACTCGAGTTCAGGAGAGAGAAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-902s1c1
Sequence:CCGGCCTCAGATCATCAAGACAGATCTCGAGATCTGTCTTGATGATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004599.2-3615s21c1
Sequence:CCGGCCTCCACCTCTCTCTCGATTTCTCGAGAAATCGAGAGAGAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004599.2-1157s21c1
Sequence:CCGGGAAAGGCGGACAACCCATAATCTCGAGATTATGGGTTGTCCGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004599.2-425s21c1
Sequence:CCGGCCTTCAGTGCAACGGTCATTCCTCGAGGAATGACCGTTGCACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004599
VALIDATED
SREBF2 MISSION shRNA shRNA Plasmid DNA
sterol regulatory element binding transcription factor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-1533s1c1
Sequence:CCGGGCCCTCTATTGGATGATGCAACTCGAGTTGCATCATCCAATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-604s1c1
Sequence:CCGGGCAACAACAGACGGTAATGATCTCGAGATCATTACCGTCTGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004599.2-1421s1c1
Sequence:CCGGGACCTGAAGATCGAGGACTTTCTCGAGAAAGTCCTCGATCTTCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004599.2-3895s1c1
Sequence:CCGGCCTGAGTTTCTCTCTCCTGAACTCGAGTTCAGGAGAGAGAAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-902s1c1
Sequence:CCGGCCTCAGATCATCAAGACAGATCTCGAGATCTGTCTTGATGATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004599.2-3615s21c1
Sequence:CCGGCCTCCACCTCTCTCTCGATTTCTCGAGAAATCGAGAGAGAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004599.2-1157s21c1
Sequence:CCGGGAAAGGCGGACAACCCATAATCTCGAGATTATGGGTTGTCCGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004599.2-425s21c1
Sequence:CCGGCCTTCAGTGCAACGGTCATTCCTCGAGGAATGACCGTTGCACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004599
VALIDATED
SREBF2 MISSION shRNA Lentiviral Transduction Particles
sterol regulatory element binding transcription factor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-1533s1c1
Sequence:CCGGGCCCTCTATTGGATGATGCAACTCGAGTTGCATCATCCAATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-604s1c1
Sequence:CCGGGCAACAACAGACGGTAATGATCTCGAGATCATTACCGTCTGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004599.2-1421s1c1
Sequence:CCGGGACCTGAAGATCGAGGACTTTCTCGAGAAAGTCCTCGATCTTCAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004599.2-3895s1c1
Sequence:CCGGCCTGAGTTTCTCTCTCCTGAACTCGAGTTCAGGAGAGAGAAACTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004599.2-902s1c1
Sequence:CCGGCCTCAGATCATCAAGACAGATCTCGAGATCTGTCTTGATGATCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004599.2-3615s21c1
Sequence:CCGGCCTCCACCTCTCTCTCGATTTCTCGAGAAATCGAGAGAGAGGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004599.2-1157s21c1
Sequence:CCGGGAAAGGCGGACAACCCATAATCTCGAGATTATGGGTTGTCCGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004599.2-425s21c1
Sequence:CCGGCCTTCAGTGCAACGGTCATTCCTCGAGGAATGACCGTTGCACTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033218
VALIDATED
SREBF2 MISSION shRNA Bacterial Glycerol Stock
sterol regulatory element binding transcription factor 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033218.1-1094s1c1
Sequence:CCGGGCGGACAACACACAATATCATCTCGAGATGATATTGTGTGTTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033218.1-4110s1c1
Sequence:CCGGCCTGACTAAGCCTTGTTCATTCTCGAGAATGAACAAGGCTTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-224s1c1
Sequence:CCGGGATGCTACAGTTTGTCAGCAACTCGAGTTGCTGACAAACTGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033218.1-599s1c1
Sequence:CCGGGCAGCCTTTGATATACCAGAACTCGAGTTCTGGTATATCAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033218.1-3878s1c1
Sequence:CCGGCCTCTGGTTCTCTTTGTTGTTCTCGAGAACAACAAAGAGAACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033218.1-2303s1c1
Sequence:CCGGCTTGGCTAGCTACTTCTTAAACTCGAGTTTAAGAAGTAGCTAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1740s1c1
Sequence:CCGGGTGATTGTCTTGAGCGTCTTTCTCGAGAAAGACGCTCAAGACAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-1218s21c1
Sequence:CCGGGCCATTGATTACATCAAATATCTCGAGATATTTGATGTAATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033218.1-3732s21c1
Sequence:CCGGTTAACACTGCTGTGGTAAATCCTCGAGGATTTACCACAGCAGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1218s1c1
Sequence:CCGGGCCATTGATTACATCAAATATCTCGAGATATTTGATGTAATCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1885s1c1
Sequence:CCGGCCAACCTACAAACCTGCTTATCTCGAGATAAGCAGGTTTGTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-1534s21c1
Sequence:CCGGACCGCTCTCGAATCCTCTTATCTCGAGATAAGAGGATTCGAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-827s21c1
Sequence:CCGGGGTGCAACCTCAGATCATTAACTCGAGTTAATGATCTGAGGTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033218
VALIDATED
SREBF2 MISSION shRNA shRNA Plasmid DNA
sterol regulatory element binding transcription factor 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033218.1-1094s1c1
Sequence:CCGGGCGGACAACACACAATATCATCTCGAGATGATATTGTGTGTTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033218.1-4110s1c1
Sequence:CCGGCCTGACTAAGCCTTGTTCATTCTCGAGAATGAACAAGGCTTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-224s1c1
Sequence:CCGGGATGCTACAGTTTGTCAGCAACTCGAGTTGCTGACAAACTGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033218.1-599s1c1
Sequence:CCGGGCAGCCTTTGATATACCAGAACTCGAGTTCTGGTATATCAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033218.1-3878s1c1
Sequence:CCGGCCTCTGGTTCTCTTTGTTGTTCTCGAGAACAACAAAGAGAACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033218.1-2303s1c1
Sequence:CCGGCTTGGCTAGCTACTTCTTAAACTCGAGTTTAAGAAGTAGCTAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1740s1c1
Sequence:CCGGGTGATTGTCTTGAGCGTCTTTCTCGAGAAAGACGCTCAAGACAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-1218s21c1
Sequence:CCGGGCCATTGATTACATCAAATATCTCGAGATATTTGATGTAATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033218.1-3732s21c1
Sequence:CCGGTTAACACTGCTGTGGTAAATCCTCGAGGATTTACCACAGCAGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1218s1c1
Sequence:CCGGGCCATTGATTACATCAAATATCTCGAGATATTTGATGTAATCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1885s1c1
Sequence:CCGGCCAACCTACAAACCTGCTTATCTCGAGATAAGCAGGTTTGTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-1534s21c1
Sequence:CCGGACCGCTCTCGAATCCTCTTATCTCGAGATAAGAGGATTCGAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-827s21c1
Sequence:CCGGGGTGCAACCTCAGATCATTAACTCGAGTTAATGATCTGAGGTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033218
VALIDATED
SREBF2 MISSION shRNA Lentiviral Transduction Particles
sterol regulatory element binding transcription factor 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033218.1-1094s1c1
Sequence:CCGGGCGGACAACACACAATATCATCTCGAGATGATATTGTGTGTTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033218.1-4110s1c1
Sequence:CCGGCCTGACTAAGCCTTGTTCATTCTCGAGAATGAACAAGGCTTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-224s1c1
Sequence:CCGGGATGCTACAGTTTGTCAGCAACTCGAGTTGCTGACAAACTGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033218.1-599s1c1
Sequence:CCGGGCAGCCTTTGATATACCAGAACTCGAGTTCTGGTATATCAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033218.1-3878s1c1
Sequence:CCGGCCTCTGGTTCTCTTTGTTGTTCTCGAGAACAACAAAGAGAACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033218.1-2303s1c1
Sequence:CCGGCTTGGCTAGCTACTTCTTAAACTCGAGTTTAAGAAGTAGCTAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1740s1c1
Sequence:CCGGGTGATTGTCTTGAGCGTCTTTCTCGAGAAAGACGCTCAAGACAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-1218s21c1
Sequence:CCGGGCCATTGATTACATCAAATATCTCGAGATATTTGATGTAATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033218.1-3732s21c1
Sequence:CCGGTTAACACTGCTGTGGTAAATCCTCGAGGATTTACCACAGCAGTGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1218s1c1
Sequence:CCGGGCCATTGATTACATCAAATATCTCGAGATATTTGATGTAATCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033218.1-1885s1c1
Sequence:CCGGCCAACCTACAAACCTGCTTATCTCGAGATAAGCAGGTTTGTAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-1534s21c1
Sequence:CCGGACCGCTCTCGAATCCTCTTATCTCGAGATAAGAGGATTCGAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033218.1-827s21c1
Sequence:CCGGGGTGCAACCTCAGATCATTAACTCGAGTTAATGATCTGAGGTTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks