EMAIL THIS PAGE TO A FRIEND

SREK1

splicing regulatory glutamine/lysine-rich protein 1

Synonyms: SFRS12 SRrp508 SRrp86
UniProtKB ID: Q8WXA9, A4FTW3, Q2M1J0, Q86X37
Gene ID:
Human(140890) Summary: This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(218543) splicing regulatory glutamine/lysine-rich protein 1
Rat(56763) splicing regulatory glutamine/lysine-rich protein 1
naked mole-rat(101706949) splicing regulatory glutamine/lysine-rich protein 1
domestic guinea pig(100731344) splicing regulatory glutamine/lysine-rich protein 1
cow(507801) splicing regulatory glutamine/lysine-rich protein 1
sheep(101122552) splicing regulatory glutamine/lysine-rich protein 1
Zebrafish(445219) splicing regulatory glutamine/lysine-rich protein 1
Horse(100050297) splicing regulatory glutamine/lysine-rich protein 1
domestic cat(101083319) splicing regulatory glutamine/lysine-rich protein 1
dog(487233) splicing regulatory glutamine/lysine-rich protein 1
chicken(427168) splicing regulatory glutamine/lysine-rich protein 1
203 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139168 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077199 Rosetta Predictions human pricing
NM_139168 Rosetta Predictions human pricing
NM_020092 Rosetta Predictions rat pricing
NM_172592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312194 predicted 2114
2 SASI_Hs02_00312195 predicted 652
3 SASI_Hs02_00312196 predicted 2086
4 SASI_Hs02_00312197 predicted 790
5 SASI_Hs02_00312198 predicted 1987
6 SASI_Hs02_00312199 predicted 2071
7 SASI_Hs02_00312200 predicted 1031
8 SASI_Hs02_00312201 predicted 2007
9 SASI_Hs02_00312202 predicted 2001
10 SASI_Hs02_00312203 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364192 predicted 2306
2 SASI_Hs01_00057195 predicted 842
3 SASI_Hs01_00057196 predicted 2275
4 SASI_Hs01_00057197 predicted 983
5 SASI_Hs01_00057198 predicted 2174
6 SASI_Hs01_00057199 predicted 2259
7 SASI_Hs02_00364193 predicted 1218
8 SASI_Hs02_00364194 predicted 2198
9 SASI_Hs02_00364195 predicted 2189
10 SASI_Hs02_00364196 predicted 1150
11 SASI_Hs01_00057193 predicted 1660
12 SASI_Hs01_00057194 predicted 1656
13 SASI_Hs01_00057200 predicted 1811
14 SASI_Hs01_00057201 predicted 480
15 SASI_Hs01_00057202 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042784 predicted 232
2 SASI_Rn01_00042785 predicted 235
3 SASI_Rn02_00262499 predicted 332
4 SASI_Rn01_00042787 predicted 360
5 SASI_Rn01_00042788 predicted 444
6 SASI_Rn01_00042789 predicted 197
7 SASI_Rn01_00042790 predicted 416
8 SASI_Rn01_00042791 predicted 528
9 SASI_Rn01_00042792 predicted 309
10 SASI_Rn01_00042793 predicted 479
11 SASI_Rn01_00042786 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023759 predicted 2184
2 SASI_Mm01_00023760 predicted 2140
3 SASI_Mm01_00023761 predicted 687
4 SASI_Mm01_00023762 predicted 833
5 SASI_Mm01_00023763 predicted 821
6 SASI_Mm01_00023764 predicted 991
7 SASI_Mm01_00023765 predicted 1092
8 SASI_Mm01_00023766 predicted 857
9 SASI_Mm01_00023767 predicted 714
10 SASI_Mm01_00023768 predicted 829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139168
VALIDATED
SREK1 MISSION shRNA Bacterial Glycerol Stock
splicing regulatory glutamine/lysine-rich protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-737s21c1
Sequence:CCGGTTAGCAGTTTGGGAGCTATACCTCGAGGTATAGCTCCCAAACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1138s21c1
Sequence:CCGGGAAGAAGTAATGAAGCGAGTACTCGAGTACTCGCTTCATTACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1310s21c1
Sequence:CCGGACAGGAGTAGATCCCATAATACTCGAGTATTATGGGATCTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139168.2-2196s21c1
Sequence:CCGGAGTGTACCTCTGCACTCAATGCTCGAGCATTGAGTGCAGAGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1077s21c1
Sequence:CCGGCTCCAACAATGCAATAGTAAACTCGAGTTTACTATTGCATTGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-758s1c1
Sequence:CCGGCTCCAACAATGCAATAGTAAACTCGAGTTTACTATTGCATTGTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-819s1c1
Sequence:CCGGGAAGAAGTAATGAAGCGAGTACTCGAGTACTCGCTTCATTACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-525s1c1
Sequence:CCGGGATGAAATTAGGAGAACGGTTCTCGAGAACCGTTCTCCTAATTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139168.x-1314s1c1
Sequence:CCGGCATGAGAAGGATCGAGACAAACTCGAGTTTGTCTCGATCCTTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139168.x-3184s1c1
Sequence:CCGGCCATCATTCTTAGGCTCACTTCTCGAGAAGTGAGCCTAAGAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139168
VALIDATED
SREK1 MISSION shRNA shRNA Plasmid DNA
splicing regulatory glutamine/lysine-rich protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-737s21c1
Sequence:CCGGTTAGCAGTTTGGGAGCTATACCTCGAGGTATAGCTCCCAAACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1138s21c1
Sequence:CCGGGAAGAAGTAATGAAGCGAGTACTCGAGTACTCGCTTCATTACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1310s21c1
Sequence:CCGGACAGGAGTAGATCCCATAATACTCGAGTATTATGGGATCTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139168.2-2196s21c1
Sequence:CCGGAGTGTACCTCTGCACTCAATGCTCGAGCATTGAGTGCAGAGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1077s21c1
Sequence:CCGGCTCCAACAATGCAATAGTAAACTCGAGTTTACTATTGCATTGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-758s1c1
Sequence:CCGGCTCCAACAATGCAATAGTAAACTCGAGTTTACTATTGCATTGTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-819s1c1
Sequence:CCGGGAAGAAGTAATGAAGCGAGTACTCGAGTACTCGCTTCATTACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-525s1c1
Sequence:CCGGGATGAAATTAGGAGAACGGTTCTCGAGAACCGTTCTCCTAATTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139168.x-1314s1c1
Sequence:CCGGCATGAGAAGGATCGAGACAAACTCGAGTTTGTCTCGATCCTTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139168.x-3184s1c1
Sequence:CCGGCCATCATTCTTAGGCTCACTTCTCGAGAAGTGAGCCTAAGAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139168
VALIDATED
SREK1 MISSION shRNA Lentiviral Transduction Particles
splicing regulatory glutamine/lysine-rich protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-737s21c1
Sequence:CCGGTTAGCAGTTTGGGAGCTATACCTCGAGGTATAGCTCCCAAACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1138s21c1
Sequence:CCGGGAAGAAGTAATGAAGCGAGTACTCGAGTACTCGCTTCATTACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1310s21c1
Sequence:CCGGACAGGAGTAGATCCCATAATACTCGAGTATTATGGGATCTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139168.2-2196s21c1
Sequence:CCGGAGTGTACCTCTGCACTCAATGCTCGAGCATTGAGTGCAGAGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139168.2-1077s21c1
Sequence:CCGGCTCCAACAATGCAATAGTAAACTCGAGTTTACTATTGCATTGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-758s1c1
Sequence:CCGGCTCCAACAATGCAATAGTAAACTCGAGTTTACTATTGCATTGTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-819s1c1
Sequence:CCGGGAAGAAGTAATGAAGCGAGTACTCGAGTACTCGCTTCATTACTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139168.x-525s1c1
Sequence:CCGGGATGAAATTAGGAGAACGGTTCTCGAGAACCGTTCTCCTAATTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_139168.x-1314s1c1
Sequence:CCGGCATGAGAAGGATCGAGACAAACTCGAGTTTGTCTCGATCCTTCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139168.x-3184s1c1
Sequence:CCGGCCATCATTCTTAGGCTCACTTCTCGAGAAGTGAGCCTAAGAATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172592
VALIDATED
SREK1 MISSION shRNA Bacterial Glycerol Stock
splicing regulatory glutamine/lysine-rich protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-741s21c1
Sequence:CCGGGCAGCGCTGGACCCAAATATTCTCGAGAATATTTGGGTCCAGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-2039s21c1
Sequence:CCGGCGAAGGTAAAGTACAGCACAACTCGAGTTGTGCTGTACTTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172592.2-776s21c1
Sequence:CCGGGATTCCACAGCCGCCACTTATCTCGAGATAAGTGGCGGCTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172592.2-2183s21c1
Sequence:CCGGTTGAGAGAGAAATCCATATATCTCGAGATATATGGATTTCTCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-876s21c1
Sequence:CCGGGCTGATCAACTACTTGAATTTCTCGAGAAATTCAAGTAGTTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172592.1-2953s1c1
Sequence:CCGGGCCTTCTACAATGTGTGGTATCTCGAGATACCACACATTGTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-1101s1c1
Sequence:CCGGGCAGCTAAGGAGTTAGAAGAACTCGAGTTCTTCTAACTCCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-876s1c1
Sequence:CCGGGCTGATCAACTACTTGAATTTCTCGAGAAATTCAAGTAGTTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172592.1-1288s1c1
Sequence:CCGGACAGGAGTAGATCCCATAATACTCGAGTATTATGGGATCTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-2039s1c1
Sequence:CCGGCGAAGGTAAAGTACAGCACAACTCGAGTTGTGCTGTACTTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172592
VALIDATED
SREK1 MISSION shRNA shRNA Plasmid DNA
splicing regulatory glutamine/lysine-rich protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-741s21c1
Sequence:CCGGGCAGCGCTGGACCCAAATATTCTCGAGAATATTTGGGTCCAGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-2039s21c1
Sequence:CCGGCGAAGGTAAAGTACAGCACAACTCGAGTTGTGCTGTACTTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172592.2-776s21c1
Sequence:CCGGGATTCCACAGCCGCCACTTATCTCGAGATAAGTGGCGGCTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172592.2-2183s21c1
Sequence:CCGGTTGAGAGAGAAATCCATATATCTCGAGATATATGGATTTCTCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-876s21c1
Sequence:CCGGGCTGATCAACTACTTGAATTTCTCGAGAAATTCAAGTAGTTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172592.1-2953s1c1
Sequence:CCGGGCCTTCTACAATGTGTGGTATCTCGAGATACCACACATTGTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-1101s1c1
Sequence:CCGGGCAGCTAAGGAGTTAGAAGAACTCGAGTTCTTCTAACTCCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-876s1c1
Sequence:CCGGGCTGATCAACTACTTGAATTTCTCGAGAAATTCAAGTAGTTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172592.1-1288s1c1
Sequence:CCGGACAGGAGTAGATCCCATAATACTCGAGTATTATGGGATCTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-2039s1c1
Sequence:CCGGCGAAGGTAAAGTACAGCACAACTCGAGTTGTGCTGTACTTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172592
VALIDATED
SREK1 MISSION shRNA Lentiviral Transduction Particles
splicing regulatory glutamine/lysine-rich protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-741s21c1
Sequence:CCGGGCAGCGCTGGACCCAAATATTCTCGAGAATATTTGGGTCCAGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-2039s21c1
Sequence:CCGGCGAAGGTAAAGTACAGCACAACTCGAGTTGTGCTGTACTTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172592.2-776s21c1
Sequence:CCGGGATTCCACAGCCGCCACTTATCTCGAGATAAGTGGCGGCTGTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172592.2-2183s21c1
Sequence:CCGGTTGAGAGAGAAATCCATATATCTCGAGATATATGGATTTCTCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172592.2-876s21c1
Sequence:CCGGGCTGATCAACTACTTGAATTTCTCGAGAAATTCAAGTAGTTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172592.1-2953s1c1
Sequence:CCGGGCCTTCTACAATGTGTGGTATCTCGAGATACCACACATTGTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-1101s1c1
Sequence:CCGGGCAGCTAAGGAGTTAGAAGAACTCGAGTTCTTCTAACTCCTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-876s1c1
Sequence:CCGGGCTGATCAACTACTTGAATTTCTCGAGAAATTCAAGTAGTTGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172592.1-1288s1c1
Sequence:CCGGACAGGAGTAGATCCCATAATACTCGAGTATTATGGGATCTACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172592.1-2039s1c1
Sequence:CCGGCGAAGGTAAAGTACAGCACAACTCGAGTTGTGCTGTACTTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks