EMAIL THIS PAGE TO A FRIEND

SREK1IP1

SREK1-interacting protein 1

Synonyms: P18SRP SFRS12IP1
UniProtKB ID: Q8N9Q2, Q32NC8
Gene ID:
Mouse(67288) splicing regulatory glutamine/lysine-rich protein 1interacting protein 1
Rat(361888) SREK1-interacting protein 1
Zebrafish(553315) SREK1-interacting protein 1
dog(609639) uncharacterized LOC609639
chicken(427158) SREK1-interacting protein 1
cow(614029) SREK1-interacting protein 1
sheep(101104603) SREK1-interacting protein 1
naked mole-rat(101717266) SREK1-interacting protein 1
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173829 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055481 MISSION® esiRNA esiRNA human SFRS12IP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173829 Rosetta Predictions human pricing
NM_001008373 Rosetta Predictions rat pricing
NM_026075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221119 predicted 812
2 SASI_Hs01_00221122 predicted 788
3 SASI_Hs01_00221121 predicted 896
4 SASI_Hs01_00221120 predicted 836
5 SASI_Hs01_00221123 predicted 951
6 SASI_Hs02_00368691 predicted 592
7 SASI_Hs01_00221124 predicted 833
8 SASI_Hs01_00221125 predicted 676
9 SASI_Hs01_00221126 predicted 927
10 SASI_Hs01_00221127 predicted 1039
11 SASI_Hs01_00221118 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097897 predicted 923
2 SASI_Rn01_00097898 predicted 802
3 SASI_Rn02_00199146 predicted 800
4 SASI_Rn02_00199147 predicted 914
5 SASI_Rn01_00097900 predicted 834
6 SASI_Rn01_00097903 predicted 978
7 SASI_Rn01_00097904 predicted 849
8 SASI_Rn01_00097905 predicted 770
9 SASI_Rn01_00097906 predicted 738
10 SASI_Rn02_00199148 predicted 753
11 SASI_Rn01_00097899 predicted 922
12 SASI_Rn01_00097901 predicted 921
13 SASI_Rn01_00097902 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064279 predicted 778
2 SASI_Mm01_00064280 predicted 783
3 SASI_Mm01_00064281 predicted 941
4 SASI_Mm01_00064282 predicted 938
5 SASI_Mm01_00064283 predicted 950
6 SASI_Mm01_00064287 predicted 759
7 SASI_Mm01_00064285 predicted 786
8 SASI_Mm01_00064286 predicted 760
9 SASI_Mm02_00329643 predicted 872
10 SASI_Mm01_00064284 predicted 746
11 SASI_Mm01_00064288 predicted 854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173829
SREK1IP1 MISSION shRNA Bacterial Glycerol Stock
SREK1-interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-279s1c1
Sequence:CCGGGATGTCAGCAGTACAAGTAGTCTCGAGACTACTTGTACTGCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173829.2-578s1c1
Sequence:CCGGGCATTCTTCTACACCTAATAGCTCGAGCTATTAGGTGTAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-282s1c1
Sequence:CCGGGTCAGCAGTACAAGTAGTGAACTCGAGTTCACTACTTGTACTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-303s1c1
Sequence:CCGGGATAGCGATGAAGAGAATGAACTCGAGTTCATTCTCTTCATCGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-308s1c1
Sequence:CCGGCGATGAAGAGAATGAAGAACTCTCGAGAGTTCTTCATTCTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173829.2-2181s1c1
Sequence:CCGGCCATGCTTAAATTCTAGGGAACTCGAGTTCCCTAGAATTTAAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173829.3-901s21c1
Sequence:CCGGGCTAGTGTTACTACTTCATAACTCGAGTTATGAAGTAGTAACACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173829.3-577s21c1
Sequence:CCGGAGCATTCTTCTACACCTAATACTCGAGTATTAGGTGTAGAAGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173829.3-627s21c1
Sequence:CCGGCTTTGGCTTAAGCCGTTAAATCTCGAGATTTAACGGCTTAAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173829
SREK1IP1 MISSION shRNA shRNA Plasmid DNA
SREK1-interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-279s1c1
Sequence:CCGGGATGTCAGCAGTACAAGTAGTCTCGAGACTACTTGTACTGCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173829.2-578s1c1
Sequence:CCGGGCATTCTTCTACACCTAATAGCTCGAGCTATTAGGTGTAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-282s1c1
Sequence:CCGGGTCAGCAGTACAAGTAGTGAACTCGAGTTCACTACTTGTACTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-303s1c1
Sequence:CCGGGATAGCGATGAAGAGAATGAACTCGAGTTCATTCTCTTCATCGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-308s1c1
Sequence:CCGGCGATGAAGAGAATGAAGAACTCTCGAGAGTTCTTCATTCTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173829.2-2181s1c1
Sequence:CCGGCCATGCTTAAATTCTAGGGAACTCGAGTTCCCTAGAATTTAAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173829.3-901s21c1
Sequence:CCGGGCTAGTGTTACTACTTCATAACTCGAGTTATGAAGTAGTAACACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173829.3-577s21c1
Sequence:CCGGAGCATTCTTCTACACCTAATACTCGAGTATTAGGTGTAGAAGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173829.3-627s21c1
Sequence:CCGGCTTTGGCTTAAGCCGTTAAATCTCGAGATTTAACGGCTTAAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173829
SREK1IP1 MISSION shRNA Lentiviral Transduction Particles
SREK1-interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-279s1c1
Sequence:CCGGGATGTCAGCAGTACAAGTAGTCTCGAGACTACTTGTACTGCTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173829.2-578s1c1
Sequence:CCGGGCATTCTTCTACACCTAATAGCTCGAGCTATTAGGTGTAGAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-282s1c1
Sequence:CCGGGTCAGCAGTACAAGTAGTGAACTCGAGTTCACTACTTGTACTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-303s1c1
Sequence:CCGGGATAGCGATGAAGAGAATGAACTCGAGTTCATTCTCTTCATCGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173829.2-308s1c1
Sequence:CCGGCGATGAAGAGAATGAAGAACTCTCGAGAGTTCTTCATTCTCTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173829.2-2181s1c1
Sequence:CCGGCCATGCTTAAATTCTAGGGAACTCGAGTTCCCTAGAATTTAAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173829.3-901s21c1
Sequence:CCGGGCTAGTGTTACTACTTCATAACTCGAGTTATGAAGTAGTAACACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173829.3-577s21c1
Sequence:CCGGAGCATTCTTCTACACCTAATACTCGAGTATTAGGTGTAGAAGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173829.3-627s21c1
Sequence:CCGGCTTTGGCTTAAGCCGTTAAATCTCGAGATTTAACGGCTTAAGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026075
VALIDATED
SREK1IP1 MISSION shRNA Bacterial Glycerol Stock
SREK1-interacting protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026075.1-188s1c1
Sequence:CCGGCTACCCTGGTCATCTGACTTTCTCGAGAAAGTCAGATGACCAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026075.1-564s1c1
Sequence:CCGGCCTTACCATTCTGAACTCACCCTCGAGGGTGAGTTCAGAATGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-584s21c1
Sequence:CCGGTAACAGCGTCTTGGGCCTAACCTCGAGGTTAGGCCCAAGACGCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-1284s21c1
Sequence:CCGGGGTAGATCCTGGGTTGATTTACTCGAGTAAATCAACCCAGGATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-404s21c1
Sequence:CCGGTCTTACTCCAGTGCCACTGAACTCGAGTTCAGTGGCACTGGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-266s21c1
Sequence:CCGGAGTAGTGAGGACAGTGATGAACTCGAGTTCATCACTGTCCTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026075
VALIDATED
SREK1IP1 MISSION shRNA shRNA Plasmid DNA
SREK1-interacting protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026075.1-188s1c1
Sequence:CCGGCTACCCTGGTCATCTGACTTTCTCGAGAAAGTCAGATGACCAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026075.1-564s1c1
Sequence:CCGGCCTTACCATTCTGAACTCACCCTCGAGGGTGAGTTCAGAATGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-584s21c1
Sequence:CCGGTAACAGCGTCTTGGGCCTAACCTCGAGGTTAGGCCCAAGACGCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-1284s21c1
Sequence:CCGGGGTAGATCCTGGGTTGATTTACTCGAGTAAATCAACCCAGGATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-404s21c1
Sequence:CCGGTCTTACTCCAGTGCCACTGAACTCGAGTTCAGTGGCACTGGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-266s21c1
Sequence:CCGGAGTAGTGAGGACAGTGATGAACTCGAGTTCATCACTGTCCTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026075
VALIDATED
SREK1IP1 MISSION shRNA Lentiviral Transduction Particles
SREK1-interacting protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026075.1-188s1c1
Sequence:CCGGCTACCCTGGTCATCTGACTTTCTCGAGAAAGTCAGATGACCAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026075.1-564s1c1
Sequence:CCGGCCTTACCATTCTGAACTCACCCTCGAGGGTGAGTTCAGAATGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-584s21c1
Sequence:CCGGTAACAGCGTCTTGGGCCTAACCTCGAGGTTAGGCCCAAGACGCTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-1284s21c1
Sequence:CCGGGGTAGATCCTGGGTTGATTTACTCGAGTAAATCAACCCAGGATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-404s21c1
Sequence:CCGGTCTTACTCCAGTGCCACTGAACTCGAGTTCAGTGGCACTGGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026075.2-266s21c1
Sequence:CCGGAGTAGTGAGGACAGTGATGAACTCGAGTTCATCACTGTCCTCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks