EMAIL THIS PAGE TO A FRIEND

SRF

serum response factor (c-fos serum response element-binding transcription factor)

Synonyms: MCM1
UniProtKB ID: P11831, Q5T648
Gene ID:
Human(6722) Summary: This gene encodes a ubiquitous nuclear protein that stimulates both cell proliferation and differentiation. It is a member of the MADS (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors. This protein binds to the serum response element (SRE) in the promoter region of target genes. This protein regulates the activity of many immediate-early genes, for example c-fos, and thereby participates in cell cycle regulation, apoptosis, cell growth, and cell differentiation. This gene is the downstream target of many pathways; for example, the mitogen-activated protein kinase pathway (MAPK) that acts through the ternary complex factors (TCFs). [provided by RefSeq, Jul 2008]
Mouse(20807) serum response factor
Rat(501099) serum response factor (c-fos serum response element-binding transcription factor)
cow(533039) serum response factor (c-fos serum response element-binding transcription factor)
sheep(101111402) serum response factor (c-fos serum response element-binding transcription factor)
naked mole-rat(101719000) serum response factor (c-fos serum response element-binding transcription factor)
domestic guinea pig(100715998) serum response factor (c-fos serum response element-binding transcription factor)
fruit fly(252723) Surf wings
chicken(396103) serum response factor (c-fos serum response element-binding transcription factor)
domestic cat(101085210) serum response factor (c-fos serum response element-binding transcription factor)
dog(612861) serum response factor (c-fos serum response element-binding transcription factor)
214 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504596 Anti-phospho-SRF (pSer77) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503835 Anti-phospho-SRF (pSer99) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2501475 Anti-SRF antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, bovine, canine, human
ELISA, western blot pricing
SAB1412239 ANTI-SRF antibody produced in mouse clone 1E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA001819 Anti-SRF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV100866 Anti-SRF antibody produced in rabbit IgG fraction of antiserum mouse, rat, rabbit, pig, canine, bovine, zebrafish, human
western blot pricing
SAB4502851 Anti-SRF antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4502852 Anti-SRF antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
WH0006722M2 Monoclonal Anti-SRF antibody produced in mouse clone 1C8, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
SAB1404406 Monoclonal Anti-SRF, (C-terminal) antibody produced in mouse clone 2G2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003131 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003471 MISSION® esiRNA esiRNA targeting human SRF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003131 Rosetta Predictions human pricing
NM_001109302 Rosetta Predictions rat pricing
NM_020493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133419 predicted 944
2 SASI_Hs01_00133420 predicted 1372
3 SASI_Hs01_00133421 predicted 781
4 SASI_Hs01_00133422 predicted 1323
5 SASI_Hs01_00133423 predicted 1654
6 SASI_Hs01_00133424 predicted 2277
7 SASI_Hs01_00133425 predicted 1867
8 SASI_Hs01_00133426 predicted 1537
9 SASI_Hs01_00133427 predicted 1169
10 SASI_Hs01_00133428 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247084 predicted 2106
2 SASI_Rn02_00247085 predicted 1983
3 SASI_Rn02_00247086 predicted 785
4 SASI_Rn02_00247087 predicted 1162
5 SASI_Rn02_00247088 predicted 1450
6 SASI_Rn02_00247089 predicted 946
7 SASI_Rn02_00247090 predicted 1019
8 SASI_Rn02_00247091 predicted 1902
9 SASI_Rn02_00247092 predicted 1912
10 SASI_Rn02_00247093 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170496 predicted 2107
2 SASI_Mm02_00325543 predicted 785
3 SASI_Mm01_00170497 predicted 2180
4 SASI_Mm01_00170499 predicted 1175
5 SASI_Mm01_00170500 predicted 1453
6 SASI_Mm01_00170501 predicted 1383
7 SASI_Mm01_00170502 predicted 2262
8 SASI_Mm01_00170503 predicted 1020
9 SASI_Mm02_00325544 predicted 1821
10 SASI_Mm01_00170504 predicted 1917
11 SASI_Mm01_00170498 predicted 2174
12 SASI_Mm01_00170505 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020493
VALIDATED
SRF MISSION shRNA Bacterial Glycerol Stock
serum response factor (c-fos serum response element-binding transcription factor)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020493.2-2110s21c1
Sequence:CCGGGCTCAATTTGCTATGAGTATTCTCGAGAATACTCATAGCAAATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020493.2-897s21c1
Sequence:CCGGGCCATGTGTATACCTTTGCCACTCGAGTGGCAAAGGTATACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020493.2-1114s21c1
Sequence:CCGGGCCAGCATTCACAGTCACCAACTCGAGTTGGTGACTGTGAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020493.2-763s21c1
Sequence:CCGGGATGGAGTTCATCGACAACAACTCGAGTTGTTGTCGATGAACTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-1114s1c1
Sequence:CCGGGCCAGCATTCACAGTCACCAACTCGAGTTGGTGACTGTGAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-763s1c1
Sequence:CCGGGATGGAGTTCATCGACAACAACTCGAGTTGTTGTCGATGAACTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020493.1-1037s1c1
Sequence:CCGGACTGGCTTTGAAGAGCCAGATCTCGAGATCTGGCTCTTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-897s1c1
Sequence:CCGGGCCATGTGTATACCTTTGCCACTCGAGTGGCAAAGGTATACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-1784s1c1
Sequence:CCGGAGCAGCAACCTCACCGAGCTACTCGAGTAGCTCGGTGAGGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020493
VALIDATED
SRF MISSION shRNA shRNA Plasmid DNA
serum response factor (c-fos serum response element-binding transcription factor)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020493.2-2110s21c1
Sequence:CCGGGCTCAATTTGCTATGAGTATTCTCGAGAATACTCATAGCAAATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020493.2-897s21c1
Sequence:CCGGGCCATGTGTATACCTTTGCCACTCGAGTGGCAAAGGTATACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020493.2-1114s21c1
Sequence:CCGGGCCAGCATTCACAGTCACCAACTCGAGTTGGTGACTGTGAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020493.2-763s21c1
Sequence:CCGGGATGGAGTTCATCGACAACAACTCGAGTTGTTGTCGATGAACTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-1114s1c1
Sequence:CCGGGCCAGCATTCACAGTCACCAACTCGAGTTGGTGACTGTGAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-763s1c1
Sequence:CCGGGATGGAGTTCATCGACAACAACTCGAGTTGTTGTCGATGAACTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020493.1-1037s1c1
Sequence:CCGGACTGGCTTTGAAGAGCCAGATCTCGAGATCTGGCTCTTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-897s1c1
Sequence:CCGGGCCATGTGTATACCTTTGCCACTCGAGTGGCAAAGGTATACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-1784s1c1
Sequence:CCGGAGCAGCAACCTCACCGAGCTACTCGAGTAGCTCGGTGAGGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020493
VALIDATED
SRF MISSION shRNA Lentiviral Transduction Particles
serum response factor (c-fos serum response element-binding transcription factor)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020493.2-2110s21c1
Sequence:CCGGGCTCAATTTGCTATGAGTATTCTCGAGAATACTCATAGCAAATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020493.2-897s21c1
Sequence:CCGGGCCATGTGTATACCTTTGCCACTCGAGTGGCAAAGGTATACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020493.2-1114s21c1
Sequence:CCGGGCCAGCATTCACAGTCACCAACTCGAGTTGGTGACTGTGAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020493.2-763s21c1
Sequence:CCGGGATGGAGTTCATCGACAACAACTCGAGTTGTTGTCGATGAACTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-1114s1c1
Sequence:CCGGGCCAGCATTCACAGTCACCAACTCGAGTTGGTGACTGTGAATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-763s1c1
Sequence:CCGGGATGGAGTTCATCGACAACAACTCGAGTTGTTGTCGATGAACTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020493.1-1037s1c1
Sequence:CCGGACTGGCTTTGAAGAGCCAGATCTCGAGATCTGGCTCTTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-897s1c1
Sequence:CCGGGCCATGTGTATACCTTTGCCACTCGAGTGGCAAAGGTATACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020493.1-1784s1c1
Sequence:CCGGAGCAGCAACCTCACCGAGCTACTCGAGTAGCTCGGTGAGGTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003131
VALIDATED
SRF MISSION shRNA Bacterial Glycerol Stock
serum response factor (c-fos serum response element-binding transcription factor)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1041s21c1
Sequence:CCGGGTGAGACAGGCCATGTGTATACTCGAGTATACACATGGCCTGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003131.2-782s21c1
Sequence:CCGGAGCGAGATGGAGATCGGTATGCTCGAGCATACCGATCTCCATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003131.2-2280s21c1
Sequence:CCGGCGATGTTTGCCATGAGTATTACTCGAGTAATACTCATGGCAAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1100s21c1
Sequence:CCGGGAGACCGGCAAGGCACTGATTCTCGAGAATCAGTGCCTTGCCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1492s21c1
Sequence:CCGGGCCTACCAGCTTCACCCTCATCTCGAGATGAGGGTGAAGCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-3575s1c1
Sequence:CCGGCCCTAACCTCTAACCCTCATTCTCGAGAATGAGGGTTAGAGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-844s1c1
Sequence:CCGGCAAGAGGAAGACGGGCATCATCTCGAGATGATGCCCGTCTTCCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-983s1c1
Sequence:CCGGGAGACCGGCAAGGCACTGATTCTCGAGAATCAGTGCCTTGCCGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-1375s1c1
Sequence:CCGGGCCTACCAGCTTCACCCTCATCTCGAGATGAGGGTGAAGCTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003131
VALIDATED
SRF MISSION shRNA shRNA Plasmid DNA
serum response factor (c-fos serum response element-binding transcription factor)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1041s21c1
Sequence:CCGGGTGAGACAGGCCATGTGTATACTCGAGTATACACATGGCCTGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003131.2-782s21c1
Sequence:CCGGAGCGAGATGGAGATCGGTATGCTCGAGCATACCGATCTCCATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003131.2-2280s21c1
Sequence:CCGGCGATGTTTGCCATGAGTATTACTCGAGTAATACTCATGGCAAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1100s21c1
Sequence:CCGGGAGACCGGCAAGGCACTGATTCTCGAGAATCAGTGCCTTGCCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1492s21c1
Sequence:CCGGGCCTACCAGCTTCACCCTCATCTCGAGATGAGGGTGAAGCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-3575s1c1
Sequence:CCGGCCCTAACCTCTAACCCTCATTCTCGAGAATGAGGGTTAGAGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-844s1c1
Sequence:CCGGCAAGAGGAAGACGGGCATCATCTCGAGATGATGCCCGTCTTCCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-983s1c1
Sequence:CCGGGAGACCGGCAAGGCACTGATTCTCGAGAATCAGTGCCTTGCCGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-1375s1c1
Sequence:CCGGGCCTACCAGCTTCACCCTCATCTCGAGATGAGGGTGAAGCTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003131
VALIDATED
SRF MISSION shRNA Lentiviral Transduction Particles
serum response factor (c-fos serum response element-binding transcription factor)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1041s21c1
Sequence:CCGGGTGAGACAGGCCATGTGTATACTCGAGTATACACATGGCCTGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003131.2-782s21c1
Sequence:CCGGAGCGAGATGGAGATCGGTATGCTCGAGCATACCGATCTCCATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003131.2-2280s21c1
Sequence:CCGGCGATGTTTGCCATGAGTATTACTCGAGTAATACTCATGGCAAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1100s21c1
Sequence:CCGGGAGACCGGCAAGGCACTGATTCTCGAGAATCAGTGCCTTGCCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003131.2-1492s21c1
Sequence:CCGGGCCTACCAGCTTCACCCTCATCTCGAGATGAGGGTGAAGCTGGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-3575s1c1
Sequence:CCGGCCCTAACCTCTAACCCTCATTCTCGAGAATGAGGGTTAGAGGTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-844s1c1
Sequence:CCGGCAAGAGGAAGACGGGCATCATCTCGAGATGATGCCCGTCTTCCTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-983s1c1
Sequence:CCGGGAGACCGGCAAGGCACTGATTCTCGAGAATCAGTGCCTTGCCGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003131.x-1375s1c1
Sequence:CCGGGCCTACCAGCTTCACCCTCATCTCGAGATGAGGGTGAAGCTGGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks