EMAIL THIS PAGE TO A FRIEND

SRFBP1

serum response factor binding protein 1

Synonyms: BUD22 P49 Rlb1 STRAP p49/STRAP
UniProtKB ID: Q8NEF9, Q5QFI2, Q96AH4, Q96DK2
Gene ID:
Mouse(67222) serum response factor binding protein 1
Rat(291469) serum response factor binding protein 1
Zebrafish(406321) serum response factor binding protein 1
domestic cat(101081780) serum response factor binding protein 1
dog(608560) serum response factor binding protein 1
chicken(426795) serum response factor binding protein 1
domestic guinea pig(100735588) serum response factor binding protein 1
cow(617136) serum response factor binding protein 1
sheep(101112478) serum response factor binding protein 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50805 Anti-SRFBP1 antibody produced in rabbit affinity isolated antibody rat, horse, bovine, human, guinea pig, zebrafish, mouse, rabbit, canine
western blot pricing
SAB2102298 Anti-SRFBP1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, canine, bovine, horse, rabbit, human, rat
western blot pricing
HPA042737 Anti-SRFBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA058150 Anti-SRFBP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152546 Rosetta Predictions human pricing
NM_001005536 Rosetta Predictions rat pricing
NM_026040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128917 predicted 496
2 SASI_Hs01_00128918 predicted 368
3 SASI_Hs01_00128919 predicted 493
4 SASI_Hs01_00128920 predicted 461
5 SASI_Hs01_00128921 predicted 1125
6 SASI_Hs01_00128923 predicted 1083
7 SASI_Hs01_00128916 predicted 1068
8 SASI_Hs01_00128924 predicted 229
9 SASI_Hs01_00128922 predicted 1126
10 SASI_Hs01_00128925 predicted 88
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040896 predicted 359
2 SASI_Rn01_00040897 predicted 391
3 SASI_Rn01_00040898 predicted 287
4 SASI_Rn01_00040899 predicted 360
5 SASI_Rn01_00040900 predicted 483
6 SASI_Rn01_00040901 predicted 1053
7 SASI_Rn02_00198390 predicted 449
8 SASI_Rn01_00040902 predicted 1045
9 SASI_Rn01_00040903 predicted 1108
10 SASI_Rn01_00040904 predicted 445
11 SASI_Rn01_00040895 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112314 predicted 329
2 SASI_Mm02_00329535 predicted 987
3 SASI_Mm02_00329536 predicted 1097
4 SASI_Mm02_00329537 predicted 507
5 SASI_Mm02_00329538 predicted 242
6 SASI_Mm02_00329539 predicted 1030
7 SASI_Mm01_00112318 predicted 272
8 SASI_Mm02_00329540 predicted 452
9 SASI_Mm01_00112320 predicted 256
10 SASI_Mm02_00329541 predicted 542
11 SASI_Mm01_00112315 predicted 260
12 SASI_Mm01_00112316 predicted 481
13 SASI_Mm01_00112317 predicted 927
14 SASI_Mm01_00112319 predicted 1170
15 SASI_Mm01_00112321 predicted 1720
16 SASI_Mm01_00112322 predicted 575
17 SASI_Mm01_00112323 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026040
VALIDATED
SRFBP1 MISSION shRNA Bacterial Glycerol Stock
serum response factor binding protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026040.2-1737s1c1
Sequence:CCGGGAACTAACTCACAAAGTCGTTCTCGAGAACGACTTTGTGAGTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026040.2-1795s1c1
Sequence:CCGGCACACACATATGTTCACATATCTCGAGATATGTGAACATATGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026040.2-224s1c1
Sequence:CCGGGCCATGAAGGAATTGAAACCTCTCGAGAGGTTTCAATTCCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-290s21c1
Sequence:CCGGTTAGTGATGATATCAACTTTGCTCGAGCAAAGTTGATATCATCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026040.3-1099s21c1
Sequence:CCGGCACTCGTTGGCTGGACCTAAACTCGAGTTTAGGTCCAGCCAACGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-81s21c1
Sequence:CCGGCCTCAATAACGAGGTTGTAAACTCGAGTTTACAACCTCGTTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026040.3-264s21c1
Sequence:CCGGACCTGATGTTGTAACTAAATCCTCGAGGATTTAGTTACAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-1033s21c1
Sequence:CCGGTGGGATGTAAGAAACGATAAACTCGAGTTTATCGTTTCTTACATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026040
VALIDATED
SRFBP1 MISSION shRNA shRNA Plasmid DNA
serum response factor binding protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026040.2-1737s1c1
Sequence:CCGGGAACTAACTCACAAAGTCGTTCTCGAGAACGACTTTGTGAGTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026040.2-1795s1c1
Sequence:CCGGCACACACATATGTTCACATATCTCGAGATATGTGAACATATGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026040.2-224s1c1
Sequence:CCGGGCCATGAAGGAATTGAAACCTCTCGAGAGGTTTCAATTCCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-290s21c1
Sequence:CCGGTTAGTGATGATATCAACTTTGCTCGAGCAAAGTTGATATCATCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026040.3-1099s21c1
Sequence:CCGGCACTCGTTGGCTGGACCTAAACTCGAGTTTAGGTCCAGCCAACGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-81s21c1
Sequence:CCGGCCTCAATAACGAGGTTGTAAACTCGAGTTTACAACCTCGTTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026040.3-264s21c1
Sequence:CCGGACCTGATGTTGTAACTAAATCCTCGAGGATTTAGTTACAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-1033s21c1
Sequence:CCGGTGGGATGTAAGAAACGATAAACTCGAGTTTATCGTTTCTTACATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026040
VALIDATED
SRFBP1 MISSION shRNA Lentiviral Transduction Particles
serum response factor binding protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026040.2-1737s1c1
Sequence:CCGGGAACTAACTCACAAAGTCGTTCTCGAGAACGACTTTGTGAGTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026040.2-1795s1c1
Sequence:CCGGCACACACATATGTTCACATATCTCGAGATATGTGAACATATGTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026040.2-224s1c1
Sequence:CCGGGCCATGAAGGAATTGAAACCTCTCGAGAGGTTTCAATTCCTTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-290s21c1
Sequence:CCGGTTAGTGATGATATCAACTTTGCTCGAGCAAAGTTGATATCATCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026040.3-1099s21c1
Sequence:CCGGCACTCGTTGGCTGGACCTAAACTCGAGTTTAGGTCCAGCCAACGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-81s21c1
Sequence:CCGGCCTCAATAACGAGGTTGTAAACTCGAGTTTACAACCTCGTTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026040.3-264s21c1
Sequence:CCGGACCTGATGTTGTAACTAAATCCTCGAGGATTTAGTTACAACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026040.3-1033s21c1
Sequence:CCGGTGGGATGTAAGAAACGATAAACTCGAGTTTATCGTTTCTTACATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152546
VALIDATED
SRFBP1 MISSION shRNA Bacterial Glycerol Stock
serum response factor binding protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-1437s1c1
Sequence:CCGGGCCCAGACTAGAGTACAATATCTCGAGATATTGTACTCTAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-343s1c1
Sequence:CCGGCCAGATTCTACTGCAACTGAACTCGAGTTCAGTTGCAGTAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152546.1-1107s1c1
Sequence:CCGGCCACTCTTTATCTGGATCTAACTCGAGTTAGATCCAGATAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-1195s1c1
Sequence:CCGGCCTCAGATCAAGAATCAGTTTCTCGAGAAACTGATTCTTGATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-235s1c1
Sequence:CCGGGCGCAAAGATTGCTTGAAGAACTCGAGTTCTTCAAGCAATCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-967s21c1
Sequence:CCGGAGTTGTCATTCTTCAGTTAAGCTCGAGCTTAACTGAAGAATGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-601s21c1
Sequence:CCGGGCGAAGAAACCAATACATAATCTCGAGATTATGTATTGGTTTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-914s21c1
Sequence:CCGGGCGGTGACGACTTCTTCATTGCTCGAGCAATGAAGAAGTCGTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-653s21c1
Sequence:CCGGGACCTAAAGCAGTGACTATTGCTCGAGCAATAGTCACTGCTTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-939s21c1
Sequence:CCGGAGTCAGACGGACACGAAAGAACTCGAGTTCTTTCGTGTCCGTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-1077s21c1
Sequence:CCGGAGAAACCAGAAAGTTAGAATCCTCGAGGATTCTAACTTTCTGGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-273s21c1
Sequence:CCGGATTGAAACCTGACATAGTAACCTCGAGGTTACTATGTCAGGTTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-297s21c1
Sequence:CCGGATCTGCTCTTGGTGATGATATCTCGAGATATCATCACCAAGAGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-1346s21c1
Sequence:CCGGTTACGTTTGATGATTGATTAGCTCGAGCTAATCAATCATCAAACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152546
VALIDATED
SRFBP1 MISSION shRNA shRNA Plasmid DNA
serum response factor binding protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-1437s1c1
Sequence:CCGGGCCCAGACTAGAGTACAATATCTCGAGATATTGTACTCTAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-343s1c1
Sequence:CCGGCCAGATTCTACTGCAACTGAACTCGAGTTCAGTTGCAGTAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152546.1-1107s1c1
Sequence:CCGGCCACTCTTTATCTGGATCTAACTCGAGTTAGATCCAGATAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-1195s1c1
Sequence:CCGGCCTCAGATCAAGAATCAGTTTCTCGAGAAACTGATTCTTGATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-235s1c1
Sequence:CCGGGCGCAAAGATTGCTTGAAGAACTCGAGTTCTTCAAGCAATCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-967s21c1
Sequence:CCGGAGTTGTCATTCTTCAGTTAAGCTCGAGCTTAACTGAAGAATGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-601s21c1
Sequence:CCGGGCGAAGAAACCAATACATAATCTCGAGATTATGTATTGGTTTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-914s21c1
Sequence:CCGGGCGGTGACGACTTCTTCATTGCTCGAGCAATGAAGAAGTCGTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-653s21c1
Sequence:CCGGGACCTAAAGCAGTGACTATTGCTCGAGCAATAGTCACTGCTTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-939s21c1
Sequence:CCGGAGTCAGACGGACACGAAAGAACTCGAGTTCTTTCGTGTCCGTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-1077s21c1
Sequence:CCGGAGAAACCAGAAAGTTAGAATCCTCGAGGATTCTAACTTTCTGGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-273s21c1
Sequence:CCGGATTGAAACCTGACATAGTAACCTCGAGGTTACTATGTCAGGTTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-297s21c1
Sequence:CCGGATCTGCTCTTGGTGATGATATCTCGAGATATCATCACCAAGAGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-1346s21c1
Sequence:CCGGTTACGTTTGATGATTGATTAGCTCGAGCTAATCAATCATCAAACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152546
VALIDATED
SRFBP1 MISSION shRNA Lentiviral Transduction Particles
serum response factor binding protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-1437s1c1
Sequence:CCGGGCCCAGACTAGAGTACAATATCTCGAGATATTGTACTCTAGTCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-343s1c1
Sequence:CCGGCCAGATTCTACTGCAACTGAACTCGAGTTCAGTTGCAGTAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152546.1-1107s1c1
Sequence:CCGGCCACTCTTTATCTGGATCTAACTCGAGTTAGATCCAGATAAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-1195s1c1
Sequence:CCGGCCTCAGATCAAGAATCAGTTTCTCGAGAAACTGATTCTTGATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152546.1-235s1c1
Sequence:CCGGGCGCAAAGATTGCTTGAAGAACTCGAGTTCTTCAAGCAATCTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-967s21c1
Sequence:CCGGAGTTGTCATTCTTCAGTTAAGCTCGAGCTTAACTGAAGAATGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-601s21c1
Sequence:CCGGGCGAAGAAACCAATACATAATCTCGAGATTATGTATTGGTTTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-914s21c1
Sequence:CCGGGCGGTGACGACTTCTTCATTGCTCGAGCAATGAAGAAGTCGTCACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-653s21c1
Sequence:CCGGGACCTAAAGCAGTGACTATTGCTCGAGCAATAGTCACTGCTTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-939s21c1
Sequence:CCGGAGTCAGACGGACACGAAAGAACTCGAGTTCTTTCGTGTCCGTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-1077s21c1
Sequence:CCGGAGAAACCAGAAAGTTAGAATCCTCGAGGATTCTAACTTTCTGGTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-273s21c1
Sequence:CCGGATTGAAACCTGACATAGTAACCTCGAGGTTACTATGTCAGGTTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-297s21c1
Sequence:CCGGATCTGCTCTTGGTGATGATATCTCGAGATATCATCACCAAGAGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152546.2-1346s21c1
Sequence:CCGGTTACGTTTGATGATTGATTAGCTCGAGCTAATCAATCATCAAACGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks