EMAIL THIS PAGE TO A FRIEND

SRGAP2

SLIT-ROBO Rho GTPase activating protein 2

Synonyms: ARHGAP34 FNBP2 SRGAP2A SRGAP3
UniProtKB ID: O75044
Gene ID:
Human(23380) Summary: This locus encodes a member of the SLIT-ROBO Rho GTPase activating protein family. The encoded protein stimulates GTPase activity of Rac1, and plays a role in cortical neuron development. This locus has several paralogous loci on human chromosome 1, resulting from segmental duplication. While this locus itself is conserved among various species, the paralogs are found only in the genus Homo, and not in the genomes of non-human great apes. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Dec 2012]
Mouse(14270) SLIT-ROBO Rho GTPase activating protein 2
Rat(360840) SLIT-ROBO Rho GTPase activating protein 2
naked mole-rat(101698931) SLIT-ROBO Rho GTPase activating protein 2
domestic guinea pig(100716665) SLIT-ROBO Rho GTPase activating protein 2
cow(519843) SLIT-ROBO Rho GTPase activating protein 2
chicken(419843) SLIT-ROBO Rho GTPase activating protein 2
domestic cat(101089234) SLIT-ROBO Rho GTPase activating protein 2
dog(478949) SLIT-ROBO Rho GTPase activating protein 2
527 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_059095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_059095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_059095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042758 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042758 Rosetta Predictions human pricing
NM_015326 Rosetta Predictions human pricing
NM_001134958 Rosetta Predictions rat pricing
NM_001081011 Rosetta Predictions mouse pricing
XM_001000816 Rosetta Predictions mouse pricing
XM_001000828 Rosetta Predictions mouse pricing
XM_001000846 Rosetta Predictions mouse pricing
XM_897130 Rosetta Predictions mouse pricing
XM_897137 Rosetta Predictions mouse pricing
XM_897163 Rosetta Predictions mouse pricing
XM_897172 Rosetta Predictions mouse pricing
XM_897180 Rosetta Predictions mouse pricing
XM_897190 Rosetta Predictions mouse pricing
XM_897199 Rosetta Predictions mouse pricing
XM_897215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311169 predicted 551
2 SASI_Hs02_00311170 predicted 773
3 SASI_Hs02_00311171 predicted 361
4 SASI_Hs02_00311172 predicted 421
5 SASI_Hs02_00311173 predicted 632
6 SASI_Hs02_00311174 predicted 803
7 SASI_Hs02_00311175 predicted 633
8 SASI_Hs02_00311176 predicted 1115
9 SASI_Hs02_00311177 predicted 888
10 SASI_Hs02_00311178 predicted 2159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136590 predicted 551
2 SASI_Hs01_00136591 predicted 779
3 SASI_Hs01_00136593 predicted 367
4 SASI_Hs01_00136594 predicted 418
5 SASI_Hs01_00136595 predicted 634
6 SASI_Hs01_00136596 predicted 800
7 SASI_Hs02_00347614 predicted 634
8 SASI_Hs01_00136597 predicted 1117
9 SASI_Hs02_00347615 predicted 889
10 SASI_Hs02_00347616 predicted 2160
11 SASI_Hs01_00136592 predicted 2592
12 SASI_Hs01_00136598 predicted 239
13 SASI_Hs01_00136599 predicted 3319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259084 predicted 1435
2 SASI_Rn02_00259085 predicted 2036
3 SASI_Rn02_00259086 predicted 864
4 SASI_Rn02_00259087 predicted 3169
5 SASI_Rn02_00259088 predicted 1971
6 SASI_Rn02_00259089 predicted 2200
7 SASI_Rn02_00259090 predicted 2670
8 SASI_Rn02_00259091 predicted 1259
9 SASI_Rn02_00259092 predicted 3254
10 SASI_Rn02_00259093 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294356 predicted 3378
2 SASI_Mm02_00294357 predicted 1280
3 SASI_Mm02_00294358 predicted 1195
4 SASI_Mm02_00294359 predicted 878
5 SASI_Mm02_00294360 predicted 1192
6 SASI_Mm02_00294361 predicted 4022
7 SASI_Mm02_00294362 predicted 3541
8 SASI_Mm02_00294363 predicted 2685
9 SASI_Mm02_00294364 predicted 1466
10 SASI_Mm02_00294365 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216509 predicted 1321
2 SASI_Mm01_00216510 predicted 669
3 SASI_Mm01_00216511 predicted 1724
4 SASI_Mm01_00216512 predicted 1964
5 SASI_Mm01_00216513 predicted 393
6 SASI_Mm01_00216514 predicted 1491
7 SASI_Mm01_00216515 predicted 1161
8 SASI_Mm01_00216516 predicted 404
9 SASI_Mm01_00216517 predicted 632
10 SASI_Mm01_00216518 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232172 predicted 3395
2 SASI_Mm01_00232173 predicted 1458
3 SASI_Mm01_00232174 predicted 1291
4 SASI_Mm01_00232175 predicted 1200
5 SASI_Mm01_00232176 predicted 877
6 SASI_Mm01_00232177 predicted 1189
7 SASI_Mm01_00232178 predicted 4034
8 SASI_Mm01_00232179 predicted 3556
9 SASI_Mm01_00232180 predicted 2698
10 SASI_Mm01_00232181 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268373 predicted 3461
2 SASI_Mm01_00268374 predicted 1459
3 SASI_Mm01_00268375 predicted 1286
4 SASI_Mm01_00268376 predicted 1204
5 SASI_Mm01_00268377 predicted 878
6 SASI_Mm01_00268378 predicted 1194
7 SASI_Mm01_00268379 predicted 4106
8 SASI_Mm01_00268380 predicted 3625
9 SASI_Mm01_00268381 predicted 2250
10 SASI_Mm01_00268382 predicted 2776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219787 predicted 892
2 SASI_Mm01_00219788 predicted 925
3 SASI_Mm01_00219789 predicted 1575
4 SASI_Mm01_00219790 predicted 892
5 SASI_Mm01_00219791 predicted 1069
6 SASI_Mm01_00219792 predicted 881
7 SASI_Mm01_00219793 predicted 1590
8 SASI_Mm01_00219794 predicted 786
9 SASI_Mm01_00219795 predicted 1073
10 SASI_Mm01_00219796 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219275 predicted 884
2 SASI_Mm01_00219276 predicted 1456
3 SASI_Mm01_00219277 predicted 1286
4 SASI_Mm01_00219278 predicted 1208
5 SASI_Mm01_00219279 predicted 3196
6 SASI_Mm01_00219280 predicted 876
7 SASI_Mm01_00219281 predicted 1188
8 SASI_Mm01_00219282 predicted 2151
9 SASI_Mm01_00219283 predicted 3278
10 SASI_Mm01_00219284 predicted 2692
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241154 predicted 890
2 SASI_Mm01_00241155 predicted 923
3 SASI_Mm01_00241156 predicted 878
4 SASI_Mm01_00241157 predicted 886
5 SASI_Mm01_00241158 predicted 878
6 SASI_Mm01_00241159 predicted 788
7 SASI_Mm01_00241160 predicted 765
8 SASI_Mm01_00241161 predicted 767
9 SASI_Mm01_00241162 predicted 816
10 SASI_Mm01_00241163 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218818 predicted 1322
2 SASI_Mm01_00218819 predicted 807
3 SASI_Mm01_00218820 predicted 1100
4 SASI_Mm01_00218821 predicted 1425
5 SASI_Mm01_00218822 predicted 1185
6 SASI_Mm01_00218823 predicted 1368
7 SASI_Mm01_00218824 predicted 596
8 SASI_Mm01_00218825 predicted 796
9 SASI_Mm01_00218826 predicted 1362
10 SASI_Mm01_00218827 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237620 predicted 1287
2 SASI_Mm01_00237621 predicted 634
3 SASI_Mm01_00237622 predicted 1687
4 SASI_Mm01_00237623 predicted 1926
5 SASI_Mm01_00237624 predicted 361
6 SASI_Mm01_00237625 predicted 1458
7 SASI_Mm01_00237626 predicted 1133
8 SASI_Mm01_00237627 predicted 369
9 SASI_Mm01_00237628 predicted 603
10 SASI_Mm01_00237629 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252893 predicted 2659
2 SASI_Mm01_00252894 predicted 735
3 SASI_Mm01_00252895 predicted 564
4 SASI_Mm01_00252896 predicted 478
5 SASI_Mm01_00252897 predicted 3068
6 SASI_Mm01_00252898 predicted 467
7 SASI_Mm01_00252899 predicted 3308
8 SASI_Mm01_00252900 predicted 2829
9 SASI_Mm01_00252901 predicted 1976
10 SASI_Mm01_00252902 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246627 predicted 3391
2 SASI_Mm01_00246628 predicted 1450
3 SASI_Mm01_00246629 predicted 1290
4 SASI_Mm01_00246630 predicted 1206
5 SASI_Mm01_00246631 predicted 875
6 SASI_Mm01_00246632 predicted 1195
7 SASI_Mm01_00246633 predicted 4028
8 SASI_Mm01_00246634 predicted 3559
9 SASI_Mm01_00246635 predicted 2697
10 SASI_Mm01_00246636 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242742 predicted 3384
2 SASI_Mm01_00242743 predicted 1456
3 SASI_Mm01_00242744 predicted 1293
4 SASI_Mm01_00242745 predicted 1207
5 SASI_Mm01_00242746 predicted 3784
6 SASI_Mm01_00242747 predicted 881
7 SASI_Mm01_00242748 predicted 1195
8 SASI_Mm01_00242749 predicted 4029
9 SASI_Mm01_00242750 predicted 3555
10 SASI_Mm01_00242751 predicted 2697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_059095
SRGAP2 MISSION shRNA Bacterial Glycerol Stock
SLIT-ROBO Rho GTPase activating protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-2781s1c1
Sequence:CCGGGCCTGTCAAGTCTGTCAAGATCTCGAGATCTTGACAGACTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1796s1c1
Sequence:CCGGGCATGGAGGATTACTGTGATACTCGAGTATCACAGTAATCCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1944s1c1
Sequence:CCGGCCGAGAGCTGTCCTTTAAGAACTCGAGTTCTTAAAGGACAGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-2528s1c1
Sequence:CCGGCTGAGGTCATTGCTCAGGATACTCGAGTATCCTGAGCAATGACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1374s1c1
Sequence:CCGGCGACCATGACATGGATTCCATCTCGAGATGGAATCCATGTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_059095
SRGAP2 MISSION shRNA shRNA Plasmid DNA
SLIT-ROBO Rho GTPase activating protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-2781s1c1
Sequence:CCGGGCCTGTCAAGTCTGTCAAGATCTCGAGATCTTGACAGACTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1796s1c1
Sequence:CCGGGCATGGAGGATTACTGTGATACTCGAGTATCACAGTAATCCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1944s1c1
Sequence:CCGGCCGAGAGCTGTCCTTTAAGAACTCGAGTTCTTAAAGGACAGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-2528s1c1
Sequence:CCGGCTGAGGTCATTGCTCAGGATACTCGAGTATCCTGAGCAATGACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1374s1c1
Sequence:CCGGCGACCATGACATGGATTCCATCTCGAGATGGAATCCATGTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_059095
SRGAP2 MISSION shRNA Lentiviral Transduction Particles
SLIT-ROBO Rho GTPase activating protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-2781s1c1
Sequence:CCGGGCCTGTCAAGTCTGTCAAGATCTCGAGATCTTGACAGACTTGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1796s1c1
Sequence:CCGGGCATGGAGGATTACTGTGATACTCGAGTATCACAGTAATCCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1944s1c1
Sequence:CCGGCCGAGAGCTGTCCTTTAAGAACTCGAGTTCTTAAAGGACAGCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-2528s1c1
Sequence:CCGGCTGAGGTCATTGCTCAGGATACTCGAGTATCCTGAGCAATGACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059095.9-1374s1c1
Sequence:CCGGCGACCATGACATGGATTCCATCTCGAGATGGAATCCATGTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019520
SRGAP2 MISSION shRNA Bacterial Glycerol Stock
SLIT-ROBO Rho GTPase activating protein 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019520.1-2149s1c1
Sequence:CCGGCCACTGCAGAACTCCAGAAATCTCGAGATTTCTGGAGTTCTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1910s1c1
Sequence:CCGGGCCAAGAAGTAATTCTGTGGACTCGAGTCCACAGAATTACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1870s1c1
Sequence:CCGGGTTCTCATCTATCATCATGCTCTCGAGAGCATGATGATAGATGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1888s1c1
Sequence:CCGGGCTGGCTCTAGGTTTCCATATCTCGAGATATGGAAACCTAGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019520
SRGAP2 MISSION shRNA shRNA Plasmid DNA
SLIT-ROBO Rho GTPase activating protein 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019520.1-2149s1c1
Sequence:CCGGCCACTGCAGAACTCCAGAAATCTCGAGATTTCTGGAGTTCTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1910s1c1
Sequence:CCGGGCCAAGAAGTAATTCTGTGGACTCGAGTCCACAGAATTACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1870s1c1
Sequence:CCGGGTTCTCATCTATCATCATGCTCTCGAGAGCATGATGATAGATGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1888s1c1
Sequence:CCGGGCTGGCTCTAGGTTTCCATATCTCGAGATATGGAAACCTAGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019520
SRGAP2 MISSION shRNA Lentiviral Transduction Particles
SLIT-ROBO Rho GTPase activating protein 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019520.1-2149s1c1
Sequence:CCGGCCACTGCAGAACTCCAGAAATCTCGAGATTTCTGGAGTTCTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1910s1c1
Sequence:CCGGGCCAAGAAGTAATTCTGTGGACTCGAGTCCACAGAATTACTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1870s1c1
Sequence:CCGGGTTCTCATCTATCATCATGCTCTCGAGAGCATGATGATAGATGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019520.1-1888s1c1
Sequence:CCGGGCTGGCTCTAGGTTTCCATATCTCGAGATATGGAAACCTAGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042758
VALIDATED
SRGAP2 MISSION shRNA Bacterial Glycerol Stock
SLIT-ROBO Rho GTPase activating protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042758.1-2946s21c1
Sequence:CCGGTCCAATCCATACTCAAATAATCTCGAGATTATTTGAGTATGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042758.1-3044s21c1
Sequence:CCGGGTTACACCAGGTGGGTTTATTCTCGAGAATAAACCCACCTGGTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042758.1-2541s21c1
Sequence:CCGGGGGTCATGTAGCCGATATTTACTCGAGTAAATATCGGCTACATGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042758.1-642s21c1
Sequence:CCGGGCAAATTGGTAAATCGGTAAACTCGAGTTTACCGATTTACCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042758.1-880s21c1
Sequence:CCGGCATGACCTATCTGACCTTATTCTCGAGAATAAGGTCAGATAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042758.1-437s21c1
Sequence:CCGGATAATATCATTCCTCGATTTGCTCGAGCAAATCGAGGAATGATATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042758
VALIDATED
SRGAP2 MISSION shRNA shRNA Plasmid DNA
SLIT-ROBO Rho GTPase activating protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042758.1-2946s21c1
Sequence:CCGGTCCAATCCATACTCAAATAATCTCGAGATTATTTGAGTATGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042758.1-3044s21c1
Sequence:CCGGGTTACACCAGGTGGGTTTATTCTCGAGAATAAACCCACCTGGTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042758.1-2541s21c1
Sequence:CCGGGGGTCATGTAGCCGATATTTACTCGAGTAAATATCGGCTACATGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042758.1-642s21c1
Sequence:CCGGGCAAATTGGTAAATCGGTAAACTCGAGTTTACCGATTTACCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042758.1-880s21c1
Sequence:CCGGCATGACCTATCTGACCTTATTCTCGAGAATAAGGTCAGATAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042758.1-437s21c1
Sequence:CCGGATAATATCATTCCTCGATTTGCTCGAGCAAATCGAGGAATGATATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042758
VALIDATED
SRGAP2 MISSION shRNA Lentiviral Transduction Particles
SLIT-ROBO Rho GTPase activating protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042758.1-2946s21c1
Sequence:CCGGTCCAATCCATACTCAAATAATCTCGAGATTATTTGAGTATGGATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042758.1-3044s21c1
Sequence:CCGGGTTACACCAGGTGGGTTTATTCTCGAGAATAAACCCACCTGGTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042758.1-2541s21c1
Sequence:CCGGGGGTCATGTAGCCGATATTTACTCGAGTAAATATCGGCTACATGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042758.1-642s21c1
Sequence:CCGGGCAAATTGGTAAATCGGTAAACTCGAGTTTACCGATTTACCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042758.1-880s21c1
Sequence:CCGGCATGACCTATCTGACCTTATTCTCGAGAATAAGGTCAGATAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042758.1-437s21c1
Sequence:CCGGATAATATCATTCCTCGATTTGCTCGAGCAAATCGAGGAATGATATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081011
SRGAP2 MISSION shRNA Bacterial Glycerol Stock
SLIT-ROBO Rho GTPase activating protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1526s21c1
Sequence:CCGGCATGACCTGTCTGATATTATTCTCGAGAATAATATCAGACAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-2577s21c1
Sequence:CCGGTTGCCTTCCTCAATCACTTATCTCGAGATAAGTGATTGAGGAAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081011.2-4200s21c1
Sequence:CCGGTGATCGGGTTGCTGCGATATCCTCGAGGATATCGCAGCAACCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1180s21c1
Sequence:CCGGGAAAGTCCTGAACGAGCTTTACTCGAGTAAAGCTCGTTCAGGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1503s21c1
Sequence:CCGGCATCTGTCTTCAAGTACTATACTCGAGTATAGTACTTGAAGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081011
SRGAP2 MISSION shRNA shRNA Plasmid DNA
SLIT-ROBO Rho GTPase activating protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1526s21c1
Sequence:CCGGCATGACCTGTCTGATATTATTCTCGAGAATAATATCAGACAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-2577s21c1
Sequence:CCGGTTGCCTTCCTCAATCACTTATCTCGAGATAAGTGATTGAGGAAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081011.2-4200s21c1
Sequence:CCGGTGATCGGGTTGCTGCGATATCCTCGAGGATATCGCAGCAACCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1180s21c1
Sequence:CCGGGAAAGTCCTGAACGAGCTTTACTCGAGTAAAGCTCGTTCAGGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1503s21c1
Sequence:CCGGCATCTGTCTTCAAGTACTATACTCGAGTATAGTACTTGAAGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081011
SRGAP2 MISSION shRNA Lentiviral Transduction Particles
SLIT-ROBO Rho GTPase activating protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1526s21c1
Sequence:CCGGCATGACCTGTCTGATATTATTCTCGAGAATAATATCAGACAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-2577s21c1
Sequence:CCGGTTGCCTTCCTCAATCACTTATCTCGAGATAAGTGATTGAGGAAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081011.2-4200s21c1
Sequence:CCGGTGATCGGGTTGCTGCGATATCCTCGAGGATATCGCAGCAACCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1180s21c1
Sequence:CCGGGAAAGTCCTGAACGAGCTTTACTCGAGTAAAGCTCGTTCAGGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081011.2-1503s21c1
Sequence:CCGGCATCTGTCTTCAAGTACTATACTCGAGTATAGTACTTGAAGACAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks