EMAIL THIS PAGE TO A FRIEND

SRGAP3

SLIT-ROBO Rho GTPase activating protein 3

Synonyms: ARHGAP14 MEGAP SRGAP2 WRP
UniProtKB ID: O43295, Q8IX13, Q8IZV8
Gene ID:
Mouse(259302) SLIT-ROBO Rho GTPase activating protein 3
Rat(500287) SLIT-ROBO Rho GTPase activating protein 3
Zebrafish(561567) SLIT-ROBO Rho GTPase activating protein 3
dog(610229) SLIT-ROBO Rho GTPase activating protein 3
Horse(100050923) SLIT-ROBO Rho GTPase activating protein 3
Horse(100052590) SLIT-ROBO Rho GTPase activating protein 3
domestic cat(101082220) SLIT-ROBO Rho GTPase activating protein 3
chicken(416115) SLIT-ROBO Rho GTPase activating protein 3
cow(512892) SLIT-ROBO Rho GTPase activating protein 3
sheep(101106370) SLIT-ROBO Rho GTPase activating protein 3
domestic guinea pig(100720492) SLIT-ROBO Rho GTPase activating protein 3
naked mole-rat(101718363) SLIT-ROBO Rho GTPase activating protein 3
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014850 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033116 Rosetta Predictions human pricing
NM_001033117 Rosetta Predictions human pricing
NM_014850 Rosetta Predictions human pricing
XM_001076245 Rosetta Predictions rat pricing
XM_575637 Rosetta Predictions rat pricing
NM_080448 Rosetta Predictions mouse pricing
NM_153070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112944 predicted 1730
2 SASI_Hs01_00112945 predicted 705
3 SASI_Hs01_00112946 predicted 1017
4 SASI_Hs01_00112947 predicted 972
5 SASI_Hs01_00112948 predicted 1449
6 SASI_Hs01_00112949 predicted 721
7 SASI_Hs01_00112950 predicted 976
8 SASI_Hs01_00112951 predicted 1735
9 SASI_Hs01_00112952 predicted 1354
10 SASI_Hs01_00112953 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062442 predicted 2389
2 SASI_Hs01_00062443 predicted 1733
3 SASI_Hs01_00062444 predicted 1017
4 SASI_Hs01_00062445 predicted 968
5 SASI_Hs01_00062446 predicted 2475
6 SASI_Hs01_00062447 predicted 1445
7 SASI_Hs01_00062448 predicted 713
8 SASI_Hs02_00308019 predicted 1346
9 SASI_Hs01_00062450 predicted 3160
10 SASI_Hs01_00062451 predicted 1616
11 SASI_Hs01_00062449 predicted 2346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037319 predicted 2459
2 SASI_Hs01_00037320 predicted 1727
3 SASI_Hs01_00037321 predicted 1020
4 SASI_Hs01_00037322 predicted 959
5 SASI_Hs01_00037323 predicted 2552
6 SASI_Hs01_00037324 predicted 1439
7 SASI_Hs01_00037325 predicted 719
8 SASI_Hs02_00346415 predicted 1347
9 SASI_Hs01_00037327 predicted 3236
10 SASI_Hs01_00037328 predicted 1621
11 SASI_Hs01_00037326 predicted 2419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352543 predicted 1833
2 SASI_Rn02_00352544 predicted 3537
3 SASI_Rn02_00352545 predicted 572
4 SASI_Rn02_00352546 predicted 3526
5 SASI_Rn02_00352547 predicted 1615
6 SASI_Rn02_00352548 predicted 872
7 SASI_Rn02_00352549 predicted 1763
8 SASI_Rn02_00352550 predicted 326
9 SASI_Rn02_00352551 predicted 1030
10 SASI_Rn02_00352552 predicted 3224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403961 predicted 1796
2 SASI_Rn02_00403962 predicted 1829
3 SASI_Rn02_00403963 predicted 570
4 SASI_Rn02_00403964 predicted 1619
5 SASI_Rn02_00403965 predicted 874
6 SASI_Rn02_00403966 predicted 1766
7 SASI_Rn02_00403967 predicted 318
8 SASI_Rn02_00403968 predicted 1029
9 SASI_Rn02_00403969 predicted 3226
10 SASI_Rn02_00403970 predicted 3215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139137 predicted 2555
2 SASI_Mm02_00338104 predicted 1058
3 SASI_Mm01_00139138 predicted 2480
4 SASI_Mm01_00139139 predicted 2286
5 SASI_Mm01_00139140 predicted 1362
6 SASI_Mm01_00139141 predicted 2431
7 SASI_Mm01_00139143 predicted 2250
8 SASI_Mm02_00338105 predicted 806
9 SASI_Mm01_00139144 predicted 1525
10 SASI_Mm01_00139145 predicted 3715
11 SASI_Mm01_00139142 predicted 3185
12 SASI_Mm01_00139146 predicted 2864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189763 predicted 970
2 SASI_Mm01_00189764 predicted 772
3 SASI_Mm01_00189765 predicted 613
4 SASI_Mm01_00189766 predicted 415
5 SASI_Mm01_00189767 predicted 728
6 SASI_Mm01_00189768 predicted 884
7 SASI_Mm01_00189769 predicted 512
8 SASI_Mm01_00189770 predicted 426
9 SASI_Mm01_00189771 predicted 911
10 SASI_Mm01_00189772 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014850
SRGAP3 MISSION shRNA Bacterial Glycerol Stock
SLIT-ROBO Rho GTPase activating protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014850.2-3191s21c1
Sequence:CCGGACGGAGCACATCTCGGATTACCTCGAGGTAATCCGAGATGTGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014850.2-2162s21c1
Sequence:CCGGCTCTCAGTGTATAGCCATAAACTCGAGTTTATGGCTATACACTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014850.2-4255s21c1
Sequence:CCGGACATGGCTTCTCCCGCATATCCTCGAGGATATGCGGGAGAAGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014850.2-4300s21c1
Sequence:CCGGCATTCTCTCTACATACGTATACTCGAGTATACGTATGTAGAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-736s1c1
Sequence:CCGGCGCAGCTCTGTGAAGAAGATTCTCGAGAATCTTCTTCACAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-145s1c1
Sequence:CCGGGCTGAATATGAAGCCCAAATACTCGAGTATTTGGGCTTCATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-855s1c1
Sequence:CCGGCGCAGCTATAAGCAAATACTACTCGAGTAGTATTTGCTTATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-2382s1c1
Sequence:CCGGGCGTGAGCTATCCTTCAAGAACTCGAGTTCTTGAAGGATAGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-1201s1c1
Sequence:CCGGGCCACCCTCAAGATAGAGAATCTCGAGATTCTCTATCTTGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014850
SRGAP3 MISSION shRNA shRNA Plasmid DNA
SLIT-ROBO Rho GTPase activating protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014850.2-3191s21c1
Sequence:CCGGACGGAGCACATCTCGGATTACCTCGAGGTAATCCGAGATGTGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014850.2-2162s21c1
Sequence:CCGGCTCTCAGTGTATAGCCATAAACTCGAGTTTATGGCTATACACTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014850.2-4255s21c1
Sequence:CCGGACATGGCTTCTCCCGCATATCCTCGAGGATATGCGGGAGAAGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014850.2-4300s21c1
Sequence:CCGGCATTCTCTCTACATACGTATACTCGAGTATACGTATGTAGAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-736s1c1
Sequence:CCGGCGCAGCTCTGTGAAGAAGATTCTCGAGAATCTTCTTCACAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-145s1c1
Sequence:CCGGGCTGAATATGAAGCCCAAATACTCGAGTATTTGGGCTTCATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-855s1c1
Sequence:CCGGCGCAGCTATAAGCAAATACTACTCGAGTAGTATTTGCTTATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-2382s1c1
Sequence:CCGGGCGTGAGCTATCCTTCAAGAACTCGAGTTCTTGAAGGATAGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-1201s1c1
Sequence:CCGGGCCACCCTCAAGATAGAGAATCTCGAGATTCTCTATCTTGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014850
SRGAP3 MISSION shRNA Lentiviral Transduction Particles
SLIT-ROBO Rho GTPase activating protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014850.2-3191s21c1
Sequence:CCGGACGGAGCACATCTCGGATTACCTCGAGGTAATCCGAGATGTGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014850.2-2162s21c1
Sequence:CCGGCTCTCAGTGTATAGCCATAAACTCGAGTTTATGGCTATACACTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014850.2-4255s21c1
Sequence:CCGGACATGGCTTCTCCCGCATATCCTCGAGGATATGCGGGAGAAGCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014850.2-4300s21c1
Sequence:CCGGCATTCTCTCTACATACGTATACTCGAGTATACGTATGTAGAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-736s1c1
Sequence:CCGGCGCAGCTCTGTGAAGAAGATTCTCGAGAATCTTCTTCACAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-145s1c1
Sequence:CCGGGCTGAATATGAAGCCCAAATACTCGAGTATTTGGGCTTCATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-855s1c1
Sequence:CCGGCGCAGCTATAAGCAAATACTACTCGAGTAGTATTTGCTTATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-2382s1c1
Sequence:CCGGGCGTGAGCTATCCTTCAAGAACTCGAGTTCTTGAAGGATAGCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014850.1-1201s1c1
Sequence:CCGGGCCACCCTCAAGATAGAGAATCTCGAGATTCTCTATCTTGAGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080448
VALIDATED
SRGAP3 MISSION shRNA Bacterial Glycerol Stock
SLIT-ROBO Rho GTPase activating protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080448.2-3782s1c1
Sequence:CCGGCCACTCTTACTTGGTGGGATTCTCGAGAATCCCACCAAGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-603s1c1
Sequence:CCGGGCAGGCCAAGTATTCTGAGAACTCGAGTTCTCAGAATACTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-681s1c1
Sequence:CCGGCGCAGCTATCAGCAAATACTACTCGAGTAGTATTTGCTGATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080448.2-1142s1c1
Sequence:CCGGGCCGATCTACAGAGTCCATAACTCGAGTTATGGACTCTGTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-2206s1c1
Sequence:CCGGCCTCGTGAACTATCCTTCAAACTCGAGTTTGAAGGATAGTTCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080448
VALIDATED
SRGAP3 MISSION shRNA shRNA Plasmid DNA
SLIT-ROBO Rho GTPase activating protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080448.2-3782s1c1
Sequence:CCGGCCACTCTTACTTGGTGGGATTCTCGAGAATCCCACCAAGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-603s1c1
Sequence:CCGGGCAGGCCAAGTATTCTGAGAACTCGAGTTCTCAGAATACTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-681s1c1
Sequence:CCGGCGCAGCTATCAGCAAATACTACTCGAGTAGTATTTGCTGATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080448.2-1142s1c1
Sequence:CCGGGCCGATCTACAGAGTCCATAACTCGAGTTATGGACTCTGTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-2206s1c1
Sequence:CCGGCCTCGTGAACTATCCTTCAAACTCGAGTTTGAAGGATAGTTCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080448
VALIDATED
SRGAP3 MISSION shRNA Lentiviral Transduction Particles
SLIT-ROBO Rho GTPase activating protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080448.2-3782s1c1
Sequence:CCGGCCACTCTTACTTGGTGGGATTCTCGAGAATCCCACCAAGTAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-603s1c1
Sequence:CCGGGCAGGCCAAGTATTCTGAGAACTCGAGTTCTCAGAATACTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-681s1c1
Sequence:CCGGCGCAGCTATCAGCAAATACTACTCGAGTAGTATTTGCTGATAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080448.2-1142s1c1
Sequence:CCGGGCCGATCTACAGAGTCCATAACTCGAGTTATGGACTCTGTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080448.2-2206s1c1
Sequence:CCGGCCTCGTGAACTATCCTTCAAACTCGAGTTTGAAGGATAGTTCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks