EMAIL THIS PAGE TO A FRIEND

SRGN

serglycin

Synonyms: PPG PRG PRG1
UniProtKB ID: P10124, B2R4L7, Q5VW06
Gene ID:
Human(5552) Summary: This gene encodes a protein best known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of many hematopoietic cells also contain a protease-resistant peptide core, which may be important for neutralizing hydrolytic enzymes. This encoded protein was found to be associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. Two transcript variants, only one of them protein-coding, have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(19073) serglycin
Rat(56782) serglycin
Zebrafish(570867) serglycin
dog(609421) serglycin
chicken(423695) serglycin
cow(509501) serglycin
sheep(101107327) serglycin
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002727 Rosetta Predictions human pricing
NM_020074 Rosetta Predictions rat pricing
NM_011157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176180 predicted 242
2 SASI_Hs01_00176181 predicted 431
3 SASI_Hs01_00176182 predicted 327
4 SASI_Hs01_00176183 predicted 285
5 SASI_Hs01_00176184 predicted 195
6 SASI_Hs01_00176185 predicted 248
7 SASI_Hs01_00176186 predicted 220
8 SASI_Hs01_00176187 predicted 345
9 SASI_Hs02_00334329 predicted 465
10 SASI_Hs01_00176188 predicted 443
11 SASI_Hs01_00176189 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262466 predicted 866
2 SASI_Rn01_00110612 predicted 775
3 SASI_Rn01_00110613 predicted 605
4 SASI_Rn01_00110614 predicted 732
5 SASI_Rn01_00110616 predicted 843
6 SASI_Rn01_00110617 predicted 723
7 SASI_Rn02_00262467 predicted 588
8 SASI_Rn01_00110618 predicted 772
9 SASI_Rn01_00110619 predicted 589
10 SASI_Rn01_00110620 predicted 708
11 SASI_Rn01_00110615 predicted 755
12 SASI_Rn01_00110621 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121872 predicted 657
2 SASI_Mm01_00121873 predicted 400
3 SASI_Mm01_00121874 predicted 550
4 SASI_Mm02_00320016 predicted 680
5 SASI_Mm01_00121875 predicted 527
6 SASI_Mm01_00121877 predicted 669
7 SASI_Mm01_00121879 predicted 461
8 SASI_Mm01_00121880 predicted 201
9 SASI_Mm01_00121881 predicted 659
10 SASI_Mm02_00320017 predicted 515
11 SASI_Mm01_00121876 predicted 358
12 SASI_Mm01_00121878 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002727
VALIDATED
SRGN MISSION shRNA Bacterial Glycerol Stock
serglycin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-1072s1c1
Sequence:CCGGGCAGAGCTAGTGGATGTGTTTCTCGAGAAACACATCCACTAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-202s1c1
Sequence:CCGGGCTGCAATCCAGACAGTAATTCTCGAGAATTACTGTCTGGATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-326s1c1
Sequence:CCGGCCAGGACTTGAATCGTATCTTCTCGAGAAGATACGATTCAAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-154s1c1
Sequence:CCGGCCTCAGTTCAAGGTTATCCTACTCGAGTAGGATAACCTTGAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-533s1c1
Sequence:CCGGACATGGATTAGAAGAGGATTTCTCGAGAAATCCTCTTCTAATCCATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-154s21c1
Sequence:CCGGCCTCAGTTCAAGGTTATCCTACTCGAGTAGGATAACCTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-326s21c1
Sequence:CCGGCCAGGACTTGAATCGTATCTTCTCGAGAAGATACGATTCAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-202s21c1
Sequence:CCGGGCTGCAATCCAGACAGTAATTCTCGAGAATTACTGTCTGGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-1072s21c1
Sequence:CCGGGCAGAGCTAGTGGATGTGTTTCTCGAGAAACACATCCACTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002727
VALIDATED
SRGN MISSION shRNA shRNA Plasmid DNA
serglycin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-1072s1c1
Sequence:CCGGGCAGAGCTAGTGGATGTGTTTCTCGAGAAACACATCCACTAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-202s1c1
Sequence:CCGGGCTGCAATCCAGACAGTAATTCTCGAGAATTACTGTCTGGATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-326s1c1
Sequence:CCGGCCAGGACTTGAATCGTATCTTCTCGAGAAGATACGATTCAAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-154s1c1
Sequence:CCGGCCTCAGTTCAAGGTTATCCTACTCGAGTAGGATAACCTTGAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-533s1c1
Sequence:CCGGACATGGATTAGAAGAGGATTTCTCGAGAAATCCTCTTCTAATCCATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-154s21c1
Sequence:CCGGCCTCAGTTCAAGGTTATCCTACTCGAGTAGGATAACCTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-326s21c1
Sequence:CCGGCCAGGACTTGAATCGTATCTTCTCGAGAAGATACGATTCAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-202s21c1
Sequence:CCGGGCTGCAATCCAGACAGTAATTCTCGAGAATTACTGTCTGGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-1072s21c1
Sequence:CCGGGCAGAGCTAGTGGATGTGTTTCTCGAGAAACACATCCACTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002727
VALIDATED
SRGN MISSION shRNA Lentiviral Transduction Particles
serglycin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-1072s1c1
Sequence:CCGGGCAGAGCTAGTGGATGTGTTTCTCGAGAAACACATCCACTAGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-202s1c1
Sequence:CCGGGCTGCAATCCAGACAGTAATTCTCGAGAATTACTGTCTGGATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-326s1c1
Sequence:CCGGCCAGGACTTGAATCGTATCTTCTCGAGAAGATACGATTCAAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-154s1c1
Sequence:CCGGCCTCAGTTCAAGGTTATCCTACTCGAGTAGGATAACCTTGAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002727.2-533s1c1
Sequence:CCGGACATGGATTAGAAGAGGATTTCTCGAGAAATCCTCTTCTAATCCATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-154s21c1
Sequence:CCGGCCTCAGTTCAAGGTTATCCTACTCGAGTAGGATAACCTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-326s21c1
Sequence:CCGGCCAGGACTTGAATCGTATCTTCTCGAGAAGATACGATTCAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-202s21c1
Sequence:CCGGGCTGCAATCCAGACAGTAATTCTCGAGAATTACTGTCTGGATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002727.2-1072s21c1
Sequence:CCGGGCAGAGCTAGTGGATGTGTTTCTCGAGAAACACATCCACTAGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011157
SRGN MISSION shRNA Bacterial Glycerol Stock
serglycin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011157.1-650s1c1
Sequence:CCGGCCTCATTAACTCGTAAGGAATCTCGAGATTCCTTACGAGTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-238s1c1
Sequence:CCGGCTCCCATGAATAATCCTGTTTCTCGAGAAACAGGATTATTCATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-367s1c1
Sequence:CCGGGCTTCCTAGGTGACATGGAATCTCGAGATTCCATGTCACCTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-399s1c1
Sequence:CCGGCCAACAGATGAAAGCAATATTCTCGAGAATATTGCTTTCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-198s1c1
Sequence:CCGGCCACAGTTTGACCTAATAGATCTCGAGATCTATTAGGTCAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011157.2-100s21c1
Sequence:CCGGGATCTTCAGTGCAAGGTTATCCTCGAGGATAACCTTGCACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011157.2-525s21c1
Sequence:CCGGCTCCATGTGGAACAATGTATTCTCGAGAATACATTGTTCCACATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011157.2-470s21c1
Sequence:CCGGAGACCAACCAGAAGACGATTTCTCGAGAAATCGTCTTCTGGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011157.2-552s21c1
Sequence:CCGGACTTAGTGTACCACGTTTAAACTCGAGTTTAAACGTGGTACACTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011157
SRGN MISSION shRNA shRNA Plasmid DNA
serglycin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011157.1-650s1c1
Sequence:CCGGCCTCATTAACTCGTAAGGAATCTCGAGATTCCTTACGAGTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-238s1c1
Sequence:CCGGCTCCCATGAATAATCCTGTTTCTCGAGAAACAGGATTATTCATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-367s1c1
Sequence:CCGGGCTTCCTAGGTGACATGGAATCTCGAGATTCCATGTCACCTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-399s1c1
Sequence:CCGGCCAACAGATGAAAGCAATATTCTCGAGAATATTGCTTTCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-198s1c1
Sequence:CCGGCCACAGTTTGACCTAATAGATCTCGAGATCTATTAGGTCAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011157.2-100s21c1
Sequence:CCGGGATCTTCAGTGCAAGGTTATCCTCGAGGATAACCTTGCACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011157.2-525s21c1
Sequence:CCGGCTCCATGTGGAACAATGTATTCTCGAGAATACATTGTTCCACATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011157.2-470s21c1
Sequence:CCGGAGACCAACCAGAAGACGATTTCTCGAGAAATCGTCTTCTGGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011157.2-552s21c1
Sequence:CCGGACTTAGTGTACCACGTTTAAACTCGAGTTTAAACGTGGTACACTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011157
SRGN MISSION shRNA Lentiviral Transduction Particles
serglycin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011157.1-650s1c1
Sequence:CCGGCCTCATTAACTCGTAAGGAATCTCGAGATTCCTTACGAGTTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-238s1c1
Sequence:CCGGCTCCCATGAATAATCCTGTTTCTCGAGAAACAGGATTATTCATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-367s1c1
Sequence:CCGGGCTTCCTAGGTGACATGGAATCTCGAGATTCCATGTCACCTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-399s1c1
Sequence:CCGGCCAACAGATGAAAGCAATATTCTCGAGAATATTGCTTTCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011157.1-198s1c1
Sequence:CCGGCCACAGTTTGACCTAATAGATCTCGAGATCTATTAGGTCAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011157.2-100s21c1
Sequence:CCGGGATCTTCAGTGCAAGGTTATCCTCGAGGATAACCTTGCACTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011157.2-525s21c1
Sequence:CCGGCTCCATGTGGAACAATGTATTCTCGAGAATACATTGTTCCACATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011157.2-470s21c1
Sequence:CCGGAGACCAACCAGAAGACGATTTCTCGAGAAATCGTCTTCTGGTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011157.2-552s21c1
Sequence:CCGGACTTAGTGTACCACGTTTAAACTCGAGTTTAAACGTGGTACACTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks