EMAIL THIS PAGE TO A FRIEND

SRI

sorcin

Synonyms: CP-22 CP22 SCN V19
UniProtKB ID: P30626, A8MTH6, D6W5Q0
Gene ID:
Human(6717) Summary: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene. [provided by RefSeq, Mar 2012]
Mouse(109552) sorcin
Rat(683667) sorcin
dog(475220) sorcin
cow(508319) sorcin
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003130 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003130 Rosetta Predictions human pricing
NM_198901 Rosetta Predictions human pricing
NM_001128190 Rosetta Predictions rat pricing
NM_001080974 Rosetta Predictions mouse pricing
NM_025618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020371 predicted 631
2 SASI_Hs01_00020372 predicted 747
3 SASI_Hs01_00020373 predicted 435
4 SASI_Hs02_00335122 predicted 756
5 SASI_Hs01_00020374 predicted 869
6 SASI_Hs01_00020375 predicted 620
7 SASI_Hs01_00020376 predicted 656
8 SASI_Hs01_00020377 predicted 627
9 SASI_Hs01_00020378 predicted 360
10 SASI_Hs01_00020379 predicted 485
11 SASI_Hs01_00020380 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030239 predicted 615
2 SASI_Hs01_00030240 predicted 725
3 SASI_Hs01_00030241 predicted 416
4 SASI_Hs02_00372399 predicted 745
5 SASI_Hs01_00030242 predicted 850
6 SASI_Hs01_00030243 predicted 607
7 SASI_Hs01_00030244 predicted 640
8 SASI_Hs01_00030245 predicted 607
9 SASI_Hs01_00030246 predicted 345
10 SASI_Hs01_00030247 predicted 473
11 SASI_Hs01_00030248 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255080 predicted 448
2 SASI_Rn02_00255081 predicted 497
3 SASI_Rn02_00255082 predicted 433
4 SASI_Rn02_00255083 predicted 233
5 SASI_Rn02_00255084 predicted 193
6 SASI_Rn02_00255085 predicted 476
7 SASI_Rn02_00255086 predicted 327
8 SASI_Rn02_00255087 predicted 224
9 SASI_Rn02_00255088 predicted 570
10 SASI_Rn02_00255089 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294216 predicted 629
2 SASI_Mm02_00294217 predicted 368
3 SASI_Mm02_00294218 predicted 456
4 SASI_Mm02_00294219 predicted 579
5 SASI_Mm02_00294220 predicted 628
6 SASI_Mm02_00294221 predicted 532
7 SASI_Mm02_00294222 predicted 597
8 SASI_Mm02_00294223 predicted 499
9 SASI_Mm02_00294224 predicted 649
10 SASI_Mm02_00294225 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149572 predicted 673
2 SASI_Mm02_00328658 predicted 398
3 SASI_Mm01_00149575 predicted 502
4 SASI_Mm01_00149576 predicted 615
5 SASI_Mm02_00328659 predicted 662
6 SASI_Mm01_00149577 predicted 567
7 SASI_Mm02_00328660 predicted 643
8 SASI_Mm02_00328661 predicted 537
9 SASI_Mm02_00328662 predicted 687
10 SASI_Mm02_00328663 predicted 880
11 SASI_Mm01_00149573 predicted 310
12 SASI_Mm01_00149574 predicted 409
13 SASI_Mm01_00149578 predicted 670
14 SASI_Mm01_00149579 predicted 227
15 SASI_Mm01_00149580 predicted 515
16 SASI_Mm01_00149581 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025618
VALIDATED
SRI MISSION shRNA Bacterial Glycerol Stock
sorcin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-225s21c1
Sequence:CCGGGACAAATTGATGCTGACGAATCTCGAGATTCGTCAGCATCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-182s21c1
Sequence:CCGGGATCCGCTATATGGTTACTTTCTCGAGAAAGTAACCATATAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-621s21c1
Sequence:CCGGGTCAACAAGGAGTTGTGAATTCTCGAGAATTCACAACTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-320s21c1
Sequence:CCGGGTTTCAATGTTGGATAGAGATCTCGAGATCTCTATCCAACATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025618.2-799s21c1
Sequence:CCGGGAACGGGATTATGACTTTATACTCGAGTATAAAGTCATAATCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025618.1-802s1c1
Sequence:CCGGGAACGGGATTATGACTTTATACTCGAGTATAAAGTCATAATCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-185s1c1
Sequence:CCGGGATCCGCTATATGGTTACTTTCTCGAGAAAGTAACCATATAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025618.1-624s1c1
Sequence:CCGGGTCAACAAGGAGTTGTGAATTCTCGAGAATTCACAACTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-323s1c1
Sequence:CCGGGTTTCAATGTTGGATAGAGATCTCGAGATCTCTATCCAACATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-228s1c1
Sequence:CCGGGACAAATTGATGCTGACGAATCTCGAGATTCGTCAGCATCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025618
VALIDATED
SRI MISSION shRNA shRNA Plasmid DNA
sorcin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-225s21c1
Sequence:CCGGGACAAATTGATGCTGACGAATCTCGAGATTCGTCAGCATCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-182s21c1
Sequence:CCGGGATCCGCTATATGGTTACTTTCTCGAGAAAGTAACCATATAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-621s21c1
Sequence:CCGGGTCAACAAGGAGTTGTGAATTCTCGAGAATTCACAACTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-320s21c1
Sequence:CCGGGTTTCAATGTTGGATAGAGATCTCGAGATCTCTATCCAACATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025618.2-799s21c1
Sequence:CCGGGAACGGGATTATGACTTTATACTCGAGTATAAAGTCATAATCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025618.1-802s1c1
Sequence:CCGGGAACGGGATTATGACTTTATACTCGAGTATAAAGTCATAATCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-185s1c1
Sequence:CCGGGATCCGCTATATGGTTACTTTCTCGAGAAAGTAACCATATAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025618.1-624s1c1
Sequence:CCGGGTCAACAAGGAGTTGTGAATTCTCGAGAATTCACAACTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-323s1c1
Sequence:CCGGGTTTCAATGTTGGATAGAGATCTCGAGATCTCTATCCAACATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-228s1c1
Sequence:CCGGGACAAATTGATGCTGACGAATCTCGAGATTCGTCAGCATCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025618
VALIDATED
SRI MISSION shRNA Lentiviral Transduction Particles
sorcin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-225s21c1
Sequence:CCGGGACAAATTGATGCTGACGAATCTCGAGATTCGTCAGCATCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-182s21c1
Sequence:CCGGGATCCGCTATATGGTTACTTTCTCGAGAAAGTAACCATATAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-621s21c1
Sequence:CCGGGTCAACAAGGAGTTGTGAATTCTCGAGAATTCACAACTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025618.2-320s21c1
Sequence:CCGGGTTTCAATGTTGGATAGAGATCTCGAGATCTCTATCCAACATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025618.2-799s21c1
Sequence:CCGGGAACGGGATTATGACTTTATACTCGAGTATAAAGTCATAATCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025618.1-802s1c1
Sequence:CCGGGAACGGGATTATGACTTTATACTCGAGTATAAAGTCATAATCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-185s1c1
Sequence:CCGGGATCCGCTATATGGTTACTTTCTCGAGAAAGTAACCATATAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025618.1-624s1c1
Sequence:CCGGGTCAACAAGGAGTTGTGAATTCTCGAGAATTCACAACTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-323s1c1
Sequence:CCGGGTTTCAATGTTGGATAGAGATCTCGAGATCTCTATCCAACATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025618.1-228s1c1
Sequence:CCGGGACAAATTGATGCTGACGAATCTCGAGATTCGTCAGCATCAATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003130
VALIDATED
SRI MISSION shRNA Bacterial Glycerol Stock
sorcin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-149s21c1
Sequence:CCGGGATCCGCTGTATGGTTACTTTCTCGAGAAAGTAACCATACAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-540s21c1
Sequence:CCGGGCGTCAAACTGAGGGCTCTTACTCGAGTAAGAGCCCTCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-287s21c1
Sequence:CCGGGTTTCAATGCTGGATAGAGATCTCGAGATCTCTATCCAGCATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-188s21c1
Sequence:CCGGGATGGGCAGATAGATGCTGATCTCGAGATCAGCATCTATCTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-435s21c1
Sequence:CCGGCCCTGACAACAATGGGATTTACTCGAGTAAATCCCATTGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-435s1c1
Sequence:CCGGCCCTGACAACAATGGGATTTACTCGAGTAAATCCCATTGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-287s1c1
Sequence:CCGGGTTTCAATGCTGGATAGAGATCTCGAGATCTCTATCCAGCATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-540s1c1
Sequence:CCGGGCGTCAAACTGAGGGCTCTTACTCGAGTAAGAGCCCTCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-188s1c1
Sequence:CCGGGATGGGCAGATAGATGCTGATCTCGAGATCAGCATCTATCTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-149s1c1
Sequence:CCGGGATCCGCTGTATGGTTACTTTCTCGAGAAAGTAACCATACAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003130
VALIDATED
SRI MISSION shRNA shRNA Plasmid DNA
sorcin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-149s21c1
Sequence:CCGGGATCCGCTGTATGGTTACTTTCTCGAGAAAGTAACCATACAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-540s21c1
Sequence:CCGGGCGTCAAACTGAGGGCTCTTACTCGAGTAAGAGCCCTCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-287s21c1
Sequence:CCGGGTTTCAATGCTGGATAGAGATCTCGAGATCTCTATCCAGCATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-188s21c1
Sequence:CCGGGATGGGCAGATAGATGCTGATCTCGAGATCAGCATCTATCTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-435s21c1
Sequence:CCGGCCCTGACAACAATGGGATTTACTCGAGTAAATCCCATTGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-435s1c1
Sequence:CCGGCCCTGACAACAATGGGATTTACTCGAGTAAATCCCATTGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-287s1c1
Sequence:CCGGGTTTCAATGCTGGATAGAGATCTCGAGATCTCTATCCAGCATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-540s1c1
Sequence:CCGGGCGTCAAACTGAGGGCTCTTACTCGAGTAAGAGCCCTCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-188s1c1
Sequence:CCGGGATGGGCAGATAGATGCTGATCTCGAGATCAGCATCTATCTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-149s1c1
Sequence:CCGGGATCCGCTGTATGGTTACTTTCTCGAGAAAGTAACCATACAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003130
VALIDATED
SRI MISSION shRNA Lentiviral Transduction Particles
sorcin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-149s21c1
Sequence:CCGGGATCCGCTGTATGGTTACTTTCTCGAGAAAGTAACCATACAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-540s21c1
Sequence:CCGGGCGTCAAACTGAGGGCTCTTACTCGAGTAAGAGCCCTCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-287s21c1
Sequence:CCGGGTTTCAATGCTGGATAGAGATCTCGAGATCTCTATCCAGCATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-188s21c1
Sequence:CCGGGATGGGCAGATAGATGCTGATCTCGAGATCAGCATCTATCTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003130.2-435s21c1
Sequence:CCGGCCCTGACAACAATGGGATTTACTCGAGTAAATCCCATTGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-435s1c1
Sequence:CCGGCCCTGACAACAATGGGATTTACTCGAGTAAATCCCATTGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-287s1c1
Sequence:CCGGGTTTCAATGCTGGATAGAGATCTCGAGATCTCTATCCAGCATTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-540s1c1
Sequence:CCGGGCGTCAAACTGAGGGCTCTTACTCGAGTAAGAGCCCTCAGTTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-188s1c1
Sequence:CCGGGATGGGCAGATAGATGCTGATCTCGAGATCAGCATCTATCTGCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003130.2-149s1c1
Sequence:CCGGGATCCGCTGTATGGTTACTTTCTCGAGAAAGTAACCATACAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks