EMAIL THIS PAGE TO A FRIEND

SRL

sarcalumenin

UniProtKB ID: Q86TD4
Gene ID:
Mouse(106393) sarcalumenin
Rat(302948) sarcalumenin
Zebrafish(449670) sarcalumenin
chicken(396269) sarcalumenin
dog(490030) sarcalumenin
cow(513912) sarcalumenin
sheep(101102031) sarcalumenin
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001098814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098814 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098814 Rosetta Predictions human pricing
XM_064152 Rosetta Predictions human pricing
XM_935383 Rosetta Predictions human pricing
NM_175347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319994 predicted 746
2 SASI_Hs02_00319995 predicted 272
3 SASI_Hs02_00319996 predicted 791
4 SASI_Hs02_00319997 predicted 868
5 SASI_Hs02_00319998 predicted 1457
6 SASI_Hs02_00319999 predicted 1169
7 SASI_Hs02_00320000 predicted 1115
8 SASI_Hs02_00320001 predicted 1134
9 SASI_Hs02_00320002 predicted 1095
10 SASI_Hs02_00320003 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_064152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263960 predicted 2141
2 SASI_Hs01_00263961 predicted 2118
3 SASI_Hs01_00263962 predicted 2162
4 SASI_Hs01_00263963 predicted 2119
5 SASI_Hs01_00263964 predicted 2238
6 SASI_Hs01_00263965 predicted 2156
7 SASI_Hs01_00263966 predicted 1650
8 SASI_Hs01_00263967 predicted 2536
9 SASI_Hs01_00263968 predicted 2831
10 SASI_Hs01_00263969 predicted 2544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248842 predicted 1663
2 SASI_Hs01_00248843 predicted 762
3 SASI_Hs01_00248844 predicted 749
4 SASI_Hs01_00248845 predicted 1664
5 SASI_Hs01_00248846 predicted 787
6 SASI_Hs01_00248847 predicted 751
7 SASI_Hs01_00248848 predicted 872
8 SASI_Hs01_00248849 predicted 1647
9 SASI_Hs01_00248850 predicted 1701
10 SASI_Hs01_00248851 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176389 predicted 1618
2 SASI_Mm01_00176390 predicted 540
3 SASI_Mm01_00176391 predicted 1763
4 SASI_Mm01_00176392 predicted 2355
5 SASI_Mm01_00176393 predicted 2791
6 SASI_Mm01_00176394 predicted 1659
7 SASI_Mm01_00176395 predicted 285
8 SASI_Mm01_00176396 predicted 973
9 SASI_Mm01_00176397 predicted 2432
10 SASI_Mm02_00346150 predicted 2714
11 SASI_Mm01_00176398 predicted 2727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175347
SRL MISSION shRNA Bacterial Glycerol Stock
sarcalumenin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175347.3-2970s1c1
Sequence:CCGGCCAGTCTACAAGGCTTCCTTTCTCGAGAAAGGAAGCCTTGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-86s1c1
Sequence:CCGGGCACGGAAGATGTTGGCAATTCTCGAGAATTGCCAACATCTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-2195s1c1
Sequence:CCGGCACAGGACTATAAGCCTGATACTCGAGTATCAGGCTTATAGTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-1253s1c1
Sequence:CCGGCCCAGCTTGATGTGGAAGATTCTCGAGAATCTTCCACATCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-2143s1c1
Sequence:CCGGCCTCTCATCAATGTCACGGAACTCGAGTTCCGTGACATTGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175347
SRL MISSION shRNA shRNA Plasmid DNA
sarcalumenin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175347.3-2970s1c1
Sequence:CCGGCCAGTCTACAAGGCTTCCTTTCTCGAGAAAGGAAGCCTTGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-86s1c1
Sequence:CCGGGCACGGAAGATGTTGGCAATTCTCGAGAATTGCCAACATCTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-2195s1c1
Sequence:CCGGCACAGGACTATAAGCCTGATACTCGAGTATCAGGCTTATAGTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-1253s1c1
Sequence:CCGGCCCAGCTTGATGTGGAAGATTCTCGAGAATCTTCCACATCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-2143s1c1
Sequence:CCGGCCTCTCATCAATGTCACGGAACTCGAGTTCCGTGACATTGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175347
SRL MISSION shRNA Lentiviral Transduction Particles
sarcalumenin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175347.3-2970s1c1
Sequence:CCGGCCAGTCTACAAGGCTTCCTTTCTCGAGAAAGGAAGCCTTGTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-86s1c1
Sequence:CCGGGCACGGAAGATGTTGGCAATTCTCGAGAATTGCCAACATCTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-2195s1c1
Sequence:CCGGCACAGGACTATAAGCCTGATACTCGAGTATCAGGCTTATAGTCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-1253s1c1
Sequence:CCGGCCCAGCTTGATGTGGAAGATTCTCGAGAATCTTCCACATCAAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175347.3-2143s1c1
Sequence:CCGGCCTCTCATCAATGTCACGGAACTCGAGTTCCGTGACATTGATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098814
SRL MISSION shRNA Bacterial Glycerol Stock
sarcalumenin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098814.1-2459s21c1
Sequence:CCGGGTTGGTGTATCCAGGTAATTTCTCGAGAAATTACCTGGATACACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-799s21c1
Sequence:CCGGCCAAATGCTCATGCGGGTTTACTCGAGTAAACCCGCATGAGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-669s21c1
Sequence:CCGGACCTCATCTTTGTCGTCTTTGCTCGAGCAAAGACGACAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-312s21c1
Sequence:CCGGGACCGTGGAGTGTTGGTAAATCTCGAGATTTACCAACACTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-1125s21c1
Sequence:CCGGTTGTGGAAGATCCCGATAAATCTCGAGATTTATCGGGATCTTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098814
SRL MISSION shRNA shRNA Plasmid DNA
sarcalumenin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098814.1-2459s21c1
Sequence:CCGGGTTGGTGTATCCAGGTAATTTCTCGAGAAATTACCTGGATACACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-799s21c1
Sequence:CCGGCCAAATGCTCATGCGGGTTTACTCGAGTAAACCCGCATGAGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-669s21c1
Sequence:CCGGACCTCATCTTTGTCGTCTTTGCTCGAGCAAAGACGACAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-312s21c1
Sequence:CCGGGACCGTGGAGTGTTGGTAAATCTCGAGATTTACCAACACTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-1125s21c1
Sequence:CCGGTTGTGGAAGATCCCGATAAATCTCGAGATTTATCGGGATCTTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098814
SRL MISSION shRNA Lentiviral Transduction Particles
sarcalumenin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098814.1-2459s21c1
Sequence:CCGGGTTGGTGTATCCAGGTAATTTCTCGAGAAATTACCTGGATACACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-799s21c1
Sequence:CCGGCCAAATGCTCATGCGGGTTTACTCGAGTAAACCCGCATGAGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-669s21c1
Sequence:CCGGACCTCATCTTTGTCGTCTTTGCTCGAGCAAAGACGACAAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-312s21c1
Sequence:CCGGGACCGTGGAGTGTTGGTAAATCTCGAGATTTACCAACACTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098814.1-1125s21c1
Sequence:CCGGTTGTGGAAGATCCCGATAAATCTCGAGATTTATCGGGATCTTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks