EMAIL THIS PAGE TO A FRIEND

SRM

spermidine synthase

Synonyms: PAPT SPDSY SPS1 SRML1
UniProtKB ID: P19623, B1AKP9, Q15511
Gene ID:
Human(6723) Summary: The polyamines putrescine, spermine, and spermidine are ubiquitous polycationic mediators of cell growth and differentiation. Spermidine synthase is one of four enzymes in the polyamine-biosynthetic pathway and carries out the final step of spermidine biosynthesis. This enzyme catalyzes the conversion of putrescine to spermidine using decarboxylated S-adenosylmethionine as the cofactor. [provided by RefSeq, Jul 2008]
Mouse(20810) spermidine synthase
Rat(84596) spermidine synthase
cow(505916) spermidine synthase
sheep(101112338) spermidine synthase
domestic guinea pig(100725210) spermidine synthase
naked mole-rat(101696345) spermidine synthase
Zebrafish(394009) spermidine synthase
chicken(771447) spermidine synthase
domestic cat(101097498) spermidine synthase
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003132 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003132 Rosetta Predictions human pricing
NM_053464 Rosetta Predictions rat pricing
NM_009272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192865 predicted 837
2 SASI_Hs01_00192866 predicted 647
3 SASI_Hs01_00192867 predicted 628
4 SASI_Hs01_00192869 predicted 946
5 SASI_Hs01_00192870 predicted 362
6 SASI_Hs01_00192871 predicted 523
7 SASI_Hs01_00192872 predicted 594
8 SASI_Hs02_00335123 predicted 575
9 SASI_Hs01_00192873 predicted 579
10 SASI_Hs01_00192874 predicted 467
11 SASI_Hs01_00192868 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073196 predicted 938
2 SASI_Rn01_00073197 predicted 619
3 SASI_Rn01_00073200 predicted 941
4 SASI_Rn01_00073201 predicted 939
5 SASI_Rn02_00266046 predicted 609
6 SASI_Rn01_00073203 predicted 261
7 SASI_Rn01_00073204 predicted 201
8 SASI_Rn02_00266047 predicted 743
9 SASI_Rn01_00073205 predicted 542
10 SASI_Rn02_00266048 predicted 479
11 SASI_Rn01_00073198 predicted 885
12 SASI_Rn01_00073199 predicted 249
13 SASI_Rn01_00073202 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082381 predicted 482
2 SASI_Mm02_00315761 predicted 660
3 SASI_Mm01_00082382 predicted 918
4 SASI_Mm02_00315762 predicted 754
5 SASI_Mm02_00315763 predicted 655
6 SASI_Mm01_00082385 predicted 764
7 SASI_Mm02_00315764 predicted 595
8 SASI_Mm01_00082386 predicted 474
9 SASI_Mm01_00082387 predicted 589
10 SASI_Mm02_00315765 predicted 446
11 SASI_Mm01_00082383 predicted 493
12 SASI_Mm01_00082384 predicted 491
13 SASI_Mm01_00082388 predicted 581
14 SASI_Mm01_00082389 predicted 770
15 SASI_Mm01_00082390 predicted 897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009272
VALIDATED
SRM MISSION shRNA Bacterial Glycerol Stock
spermidine synthase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-935s21c1
Sequence:CCGGGAAATACTATAACTCGGACATCTCGAGATGTCCGAGTTATAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009272.4-1050s21c1
Sequence:CCGGCAATCGGATTGGACCAAGGATCTCGAGATCCTTGGTCCAATCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-248s21c1
Sequence:CCGGGTACCAAGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-475s21c1
Sequence:CCGGGCGAGATTGATGAGGATGTCACTCGAGTGACATCCTCATCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-656s21c1
Sequence:CCGGCCTCTTCAAGGAGTCCTATTACTCGAGTAATAGGACTCCTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-1054s1c1
Sequence:CCGGCAATCGGATTGGACCAAGGATCTCGAGATCCTTGGTCCAATCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-479s1c1
Sequence:CCGGGCGAGATTGATGAGGATGTCACTCGAGTGACATCCTCATCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-252s1c1
Sequence:CCGGGTACCAAGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-939s1c1
Sequence:CCGGGAAATACTATAACTCGGACATCTCGAGATGTCCGAGTTATAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-660s1c1
Sequence:CCGGCCTCTTCAAGGAGTCCTATTACTCGAGTAATAGGACTCCTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009272
VALIDATED
SRM MISSION shRNA shRNA Plasmid DNA
spermidine synthase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-935s21c1
Sequence:CCGGGAAATACTATAACTCGGACATCTCGAGATGTCCGAGTTATAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009272.4-1050s21c1
Sequence:CCGGCAATCGGATTGGACCAAGGATCTCGAGATCCTTGGTCCAATCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-248s21c1
Sequence:CCGGGTACCAAGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-475s21c1
Sequence:CCGGGCGAGATTGATGAGGATGTCACTCGAGTGACATCCTCATCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-656s21c1
Sequence:CCGGCCTCTTCAAGGAGTCCTATTACTCGAGTAATAGGACTCCTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-1054s1c1
Sequence:CCGGCAATCGGATTGGACCAAGGATCTCGAGATCCTTGGTCCAATCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-479s1c1
Sequence:CCGGGCGAGATTGATGAGGATGTCACTCGAGTGACATCCTCATCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-252s1c1
Sequence:CCGGGTACCAAGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-939s1c1
Sequence:CCGGGAAATACTATAACTCGGACATCTCGAGATGTCCGAGTTATAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-660s1c1
Sequence:CCGGCCTCTTCAAGGAGTCCTATTACTCGAGTAATAGGACTCCTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009272
VALIDATED
SRM MISSION shRNA Lentiviral Transduction Particles
spermidine synthase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-935s21c1
Sequence:CCGGGAAATACTATAACTCGGACATCTCGAGATGTCCGAGTTATAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009272.4-1050s21c1
Sequence:CCGGCAATCGGATTGGACCAAGGATCTCGAGATCCTTGGTCCAATCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-248s21c1
Sequence:CCGGGTACCAAGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-475s21c1
Sequence:CCGGGCGAGATTGATGAGGATGTCACTCGAGTGACATCCTCATCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009272.4-656s21c1
Sequence:CCGGCCTCTTCAAGGAGTCCTATTACTCGAGTAATAGGACTCCTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-1054s1c1
Sequence:CCGGCAATCGGATTGGACCAAGGATCTCGAGATCCTTGGTCCAATCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-479s1c1
Sequence:CCGGGCGAGATTGATGAGGATGTCACTCGAGTGACATCCTCATCAATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-252s1c1
Sequence:CCGGGTACCAAGACATCCTCGTCTTCTCGAGAAGACGAGGATGTCTTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-939s1c1
Sequence:CCGGGAAATACTATAACTCGGACATCTCGAGATGTCCGAGTTATAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009272.2-660s1c1
Sequence:CCGGCCTCTTCAAGGAGTCCTATTACTCGAGTAATAGGACTCCTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003132
VALIDATED
SRM MISSION shRNA Bacterial Glycerol Stock
spermidine synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-478s21c1
Sequence:CCGGCATCCAAGTCTCCAAGAAGTTCTCGAGAACTTCTTGGAGACTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-514s21c1
Sequence:CCGGCATTGGCTACTCTAGCTCGAACTCGAGTTCGAGCTAGAGTAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-832s21c1
Sequence:CCGGCTTCATGCTGTGCAGCAAGAACTCGAGTTCTTGCTGCACAGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-638s21c1
Sequence:CCGGAGTCTCTTCAAGGAGTCCTATCTCGAGATAGGACTCCTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-950s21c1
Sequence:CCGGGCCTTTGTGCTGCCCGAGTTTCTCGAGAAACTCGGGCAGCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-629s1c1
Sequence:CCGGAGTCTCTTCAAGGAGTCCTATCTCGAGATAGGACTCCTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003132.1-823s1c1
Sequence:CCGGCTTCATGCTGTGCAGCAAGAACTCGAGTTCTTGCTGCACAGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-469s1c1
Sequence:CCGGCATCCAAGTCTCCAAGAAGTTCTCGAGAACTTCTTGGAGACTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-505s1c1
Sequence:CCGGCATTGGCTACTCTAGCTCGAACTCGAGTTCGAGCTAGAGTAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-941s1c1
Sequence:CCGGGCCTTTGTGCTGCCCGAGTTTCTCGAGAAACTCGGGCAGCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003132
VALIDATED
SRM MISSION shRNA shRNA Plasmid DNA
spermidine synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-478s21c1
Sequence:CCGGCATCCAAGTCTCCAAGAAGTTCTCGAGAACTTCTTGGAGACTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-514s21c1
Sequence:CCGGCATTGGCTACTCTAGCTCGAACTCGAGTTCGAGCTAGAGTAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-832s21c1
Sequence:CCGGCTTCATGCTGTGCAGCAAGAACTCGAGTTCTTGCTGCACAGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-638s21c1
Sequence:CCGGAGTCTCTTCAAGGAGTCCTATCTCGAGATAGGACTCCTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-950s21c1
Sequence:CCGGGCCTTTGTGCTGCCCGAGTTTCTCGAGAAACTCGGGCAGCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-629s1c1
Sequence:CCGGAGTCTCTTCAAGGAGTCCTATCTCGAGATAGGACTCCTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003132.1-823s1c1
Sequence:CCGGCTTCATGCTGTGCAGCAAGAACTCGAGTTCTTGCTGCACAGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-469s1c1
Sequence:CCGGCATCCAAGTCTCCAAGAAGTTCTCGAGAACTTCTTGGAGACTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-505s1c1
Sequence:CCGGCATTGGCTACTCTAGCTCGAACTCGAGTTCGAGCTAGAGTAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-941s1c1
Sequence:CCGGGCCTTTGTGCTGCCCGAGTTTCTCGAGAAACTCGGGCAGCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003132
VALIDATED
SRM MISSION shRNA Lentiviral Transduction Particles
spermidine synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-478s21c1
Sequence:CCGGCATCCAAGTCTCCAAGAAGTTCTCGAGAACTTCTTGGAGACTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-514s21c1
Sequence:CCGGCATTGGCTACTCTAGCTCGAACTCGAGTTCGAGCTAGAGTAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-832s21c1
Sequence:CCGGCTTCATGCTGTGCAGCAAGAACTCGAGTTCTTGCTGCACAGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-638s21c1
Sequence:CCGGAGTCTCTTCAAGGAGTCCTATCTCGAGATAGGACTCCTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003132.2-950s21c1
Sequence:CCGGGCCTTTGTGCTGCCCGAGTTTCTCGAGAAACTCGGGCAGCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-629s1c1
Sequence:CCGGAGTCTCTTCAAGGAGTCCTATCTCGAGATAGGACTCCTTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003132.1-823s1c1
Sequence:CCGGCTTCATGCTGTGCAGCAAGAACTCGAGTTCTTGCTGCACAGCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-469s1c1
Sequence:CCGGCATCCAAGTCTCCAAGAAGTTCTCGAGAACTTCTTGGAGACTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-505s1c1
Sequence:CCGGCATTGGCTACTCTAGCTCGAACTCGAGTTCGAGCTAGAGTAGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003132.1-941s1c1
Sequence:CCGGGCCTTTGTGCTGCCCGAGTTTCTCGAGAAACTCGGGCAGCACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks