EMAIL THIS PAGE TO A FRIEND

SRMS

src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites

Synonyms: C20orf148 SRM dJ697K14.1
UniProtKB ID: Q9H3Y6
Gene ID:
Mouse(20811) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Rat(296472) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
chicken(419246) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Horse(100060563) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
domestic cat(101100042) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
dog(477286) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
naked mole-rat(101710519) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
domestic guinea pig(100731347) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
cow(521816) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
sheep(101118124) src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0993 Phosphotyrosine SRMS / Tyrosine-protein Kinase Srms ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080823 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046201 MISSION® esiRNA esiRNA targeting mouse Srms (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080823 Rosetta Predictions human pricing
NM_001011961 Rosetta Predictions rat pricing
XM_575301 Rosetta Predictions rat pricing
NM_011481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173076 predicted 1192
2 SASI_Hs01_00173077 predicted 199
3 SASI_Hs01_00173078 predicted 930
4 SASI_Hs01_00173079 predicted 295
5 SASI_Hs01_00173080 predicted 1125
6 SASI_Hs01_00173081 predicted 797
7 SASI_Hs01_00173082 predicted 347
8 SASI_Hs01_00173083 predicted 1235
9 SASI_Hs01_00173084 predicted 1100
10 SASI_Hs02_00362600 predicted 580
11 SASI_Hs01_00173085 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108176 predicted 982
2 SASI_Rn01_00108177 predicted 622
3 SASI_Rn01_00108178 predicted 1908
4 SASI_Rn01_00108179 predicted 1382
5 SASI_Rn01_00108180 predicted 1679
6 SASI_Rn01_00108181 predicted 1320
7 SASI_Rn01_00108183 predicted 1406
8 SASI_Rn02_00199980 predicted 1358
9 SASI_Rn01_00108185 predicted 818
10 SASI_Rn02_00199981 predicted 997
11 SASI_Rn01_00108182 predicted 1778
12 SASI_Rn01_00108184 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152763 predicted 1813
2 SASI_Rn01_00152764 predicted 1600
3 SASI_Rn01_00152765 predicted 1286
4 SASI_Rn01_00152766 predicted 1709
5 SASI_Rn01_00152767 predicted 1590
6 SASI_Rn01_00152768 predicted 1583
7 SASI_Rn01_00152769 predicted 1314
8 SASI_Rn01_00152770 predicted 1616
9 SASI_Rn01_00152771 predicted 1349
10 SASI_Rn01_00152772 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094072 predicted 695
2 SASI_Mm01_00094073 predicted 798
3 SASI_Mm01_00094074 predicted 1305
4 SASI_Mm01_00094075 predicted 1681
5 SASI_Mm01_00094076 predicted 1632
6 SASI_Mm01_00094077 predicted 1716
7 SASI_Mm01_00094078 predicted 1797
8 SASI_Mm01_00094079 predicted 1267
9 SASI_Mm01_00094080 predicted 1137
10 SASI_Mm01_00094081 predicted 1416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080823
SRMS MISSION shRNA Bacterial Glycerol Stock
src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-942s1c1
Sequence:CCGGGTCACGGAACTCATGCGCAAGCTCGAGCTTGCGCATGAGTTCCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-1128s1c1
Sequence:CCGGGCCTGCAAGGTGGCTGACTTCCTCGAGGAAGTCAGCCACCTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-828s1c1
Sequence:CCGGGCCAACATGAAGCTCACTGACCTCGAGGTCAGTGAGCTTCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-803s1c1
Sequence:CCGGCGTGGCGATCAAGGTCATCAACTCGAGTTGATGACCTTGATCGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-930s1c1
Sequence:CCGGCCTGTGTACATCGTCACGGAACTCGAGTTCCGTGACGATGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1231s1c1
Sequence:CCGGCGGCCAATTATCGTGTCTTCTCTCGAGAGAAGACACGATAATTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1235s1c1
Sequence:CCGGCAATTATCGTGTCTTCTCCCACTCGAGTGGGAGAAGACACGATAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1319s1c1
Sequence:CCGGCTATGAAGGGATGACCAACCACTCGAGTGGTTGGTCATCCCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-814s1c1
Sequence:CCGGAGGTCATCAAGTCAGCCAACACTCGAGTGTTGGCTGACTTGATGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-626s1c1
Sequence:CCGGCTACTACAAGGCCAACTGGAACTCGAGTTCCAGTTGGCCTTGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080823
SRMS MISSION shRNA shRNA Plasmid DNA
src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-942s1c1
Sequence:CCGGGTCACGGAACTCATGCGCAAGCTCGAGCTTGCGCATGAGTTCCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-1128s1c1
Sequence:CCGGGCCTGCAAGGTGGCTGACTTCCTCGAGGAAGTCAGCCACCTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-828s1c1
Sequence:CCGGGCCAACATGAAGCTCACTGACCTCGAGGTCAGTGAGCTTCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-803s1c1
Sequence:CCGGCGTGGCGATCAAGGTCATCAACTCGAGTTGATGACCTTGATCGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-930s1c1
Sequence:CCGGCCTGTGTACATCGTCACGGAACTCGAGTTCCGTGACGATGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1231s1c1
Sequence:CCGGCGGCCAATTATCGTGTCTTCTCTCGAGAGAAGACACGATAATTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1235s1c1
Sequence:CCGGCAATTATCGTGTCTTCTCCCACTCGAGTGGGAGAAGACACGATAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1319s1c1
Sequence:CCGGCTATGAAGGGATGACCAACCACTCGAGTGGTTGGTCATCCCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-814s1c1
Sequence:CCGGAGGTCATCAAGTCAGCCAACACTCGAGTGTTGGCTGACTTGATGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-626s1c1
Sequence:CCGGCTACTACAAGGCCAACTGGAACTCGAGTTCCAGTTGGCCTTGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080823
SRMS MISSION shRNA Lentiviral Transduction Particles
src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-942s1c1
Sequence:CCGGGTCACGGAACTCATGCGCAAGCTCGAGCTTGCGCATGAGTTCCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-1128s1c1
Sequence:CCGGGCCTGCAAGGTGGCTGACTTCCTCGAGGAAGTCAGCCACCTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-828s1c1
Sequence:CCGGGCCAACATGAAGCTCACTGACCTCGAGGTCAGTGAGCTTCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-803s1c1
Sequence:CCGGCGTGGCGATCAAGGTCATCAACTCGAGTTGATGACCTTGATCGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.2-930s1c1
Sequence:CCGGCCTGTGTACATCGTCACGGAACTCGAGTTCCGTGACGATGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1231s1c1
Sequence:CCGGCGGCCAATTATCGTGTCTTCTCTCGAGAGAAGACACGATAATTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1235s1c1
Sequence:CCGGCAATTATCGTGTCTTCTCCCACTCGAGTGGGAGAAGACACGATAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-1319s1c1
Sequence:CCGGCTATGAAGGGATGACCAACCACTCGAGTGGTTGGTCATCCCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-814s1c1
Sequence:CCGGAGGTCATCAAGTCAGCCAACACTCGAGTGTTGGCTGACTTGATGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080823.x-626s1c1
Sequence:CCGGCTACTACAAGGCCAACTGGAACTCGAGTTCCAGTTGGCCTTGTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011481
SRMS MISSION shRNA Bacterial Glycerol Stock
src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1647s1c1
Sequence:CCGGGCTGCTAATTACCGTGTCTTTCTCGAGAAAGACACGGTAATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1347s1c1
Sequence:CCGGCCTGTGTACATCGTTACTGAACTCGAGTTCAGTAACGATGTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1766s1c1
Sequence:CCGGACAGCAGATTAGTCGTGGATACTCGAGTATCCACGACTAATCTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1037s1c1
Sequence:CCGGGCTGGCTTACTACAAGACCAACTCGAGTTGGTCTTGTAGTAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1134s1c1
Sequence:CCGGCCACGTTCAGAATTTGTCCTTCTCGAGAAGGACAAATTCTGAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011481.3-2075s21c1
Sequence:CCGGCACAGGCTGGTGCCTACATATCTCGAGATATGTAGGCACCAGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1876s21c1
Sequence:CCGGGAGAAGCTGAATGCCATAAACCTCGAGGTTTATGGCATTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1298s21c1
Sequence:CCGGTGATCCGGCTGCACGCTATATCTCGAGATATAGCGTGCAGCCGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1129s21c1
Sequence:CCGGGAATTTGTCCTTCGGAGAAAGCTCGAGCTTTCTCCGAAGGACAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011481
SRMS MISSION shRNA shRNA Plasmid DNA
src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1647s1c1
Sequence:CCGGGCTGCTAATTACCGTGTCTTTCTCGAGAAAGACACGGTAATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1347s1c1
Sequence:CCGGCCTGTGTACATCGTTACTGAACTCGAGTTCAGTAACGATGTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1766s1c1
Sequence:CCGGACAGCAGATTAGTCGTGGATACTCGAGTATCCACGACTAATCTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1037s1c1
Sequence:CCGGGCTGGCTTACTACAAGACCAACTCGAGTTGGTCTTGTAGTAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1134s1c1
Sequence:CCGGCCACGTTCAGAATTTGTCCTTCTCGAGAAGGACAAATTCTGAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011481.3-2075s21c1
Sequence:CCGGCACAGGCTGGTGCCTACATATCTCGAGATATGTAGGCACCAGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1876s21c1
Sequence:CCGGGAGAAGCTGAATGCCATAAACCTCGAGGTTTATGGCATTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1298s21c1
Sequence:CCGGTGATCCGGCTGCACGCTATATCTCGAGATATAGCGTGCAGCCGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1129s21c1
Sequence:CCGGGAATTTGTCCTTCGGAGAAAGCTCGAGCTTTCTCCGAAGGACAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011481
SRMS MISSION shRNA Lentiviral Transduction Particles
src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1647s1c1
Sequence:CCGGGCTGCTAATTACCGTGTCTTTCTCGAGAAAGACACGGTAATTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1347s1c1
Sequence:CCGGCCTGTGTACATCGTTACTGAACTCGAGTTCAGTAACGATGTACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1766s1c1
Sequence:CCGGACAGCAGATTAGTCGTGGATACTCGAGTATCCACGACTAATCTGCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1037s1c1
Sequence:CCGGGCTGGCTTACTACAAGACCAACTCGAGTTGGTCTTGTAGTAAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011481.2-1134s1c1
Sequence:CCGGCCACGTTCAGAATTTGTCCTTCTCGAGAAGGACAAATTCTGAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011481.3-2075s21c1
Sequence:CCGGCACAGGCTGGTGCCTACATATCTCGAGATATGTAGGCACCAGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1876s21c1
Sequence:CCGGGAGAAGCTGAATGCCATAAACCTCGAGGTTTATGGCATTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1298s21c1
Sequence:CCGGTGATCCGGCTGCACGCTATATCTCGAGATATAGCGTGCAGCCGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011481.3-1129s21c1
Sequence:CCGGGAATTTGTCCTTCGGAGAAAGCTCGAGCTTTCTCCGAAGGACAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks