EMAIL THIS PAGE TO A FRIEND

SRP14

signal recognition particle 14kDa (homologous Alu RNA binding protein)

Synonyms: ALURBP
UniProtKB ID: P37108, B5BUF5, Q6B0K5, Q96Q14
Gene ID:
Mouse(20813) signal recognition particle 14
Rat(296076) signal recognition particle 14
fruit fly(42436) Signal recognition particle protein 14
Zebrafish(619260) signal recognition particle 14
chicken(423284) signal recognition particle 14kDa (homologous Alu RNA binding protein)
domestic cat(101091701) signal recognition particle 14kDa (homologous Alu RNA binding protein)
dog(403930) signal recognition particle 14kDa (homologous Alu RNA binding protein)
domestic guinea pig(100713306) signal recognition particle 14kDa (homologous Alu RNA binding protein)
naked mole-rat(101704635) signal recognition particle 14kDa (homologous Alu RNA binding protein)
cow(512792) signal recognition particle 14kDa (homologous Alu RNA binding protein)
sheep(100135456) signal recognition particle 14kDa (homologous Alu RNA binding protein)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40454 Anti-SRP14 antibody produced in rabbit IgG fraction of antiserum human, canine, sheep, bovine, mouse, rabbit, zebrafish, rat, guinea pig, horse
immunohistochemistry, western blot pricing
SAB2700245 Anti-SRP14 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2106514 Anti-SRP14 antibody produced in rabbit affinity isolated antibody guinea pig, sheep, human, horse, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003134 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003134 Rosetta Predictions human pricing
NM_001106497 Rosetta Predictions rat pricing
NM_009273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335124 predicted 841
2 SASI_Hs02_00335125 predicted 860
3 SASI_Hs02_00335126 predicted 759
4 SASI_Hs02_00335127 predicted 880
5 SASI_Hs02_00335128 predicted 807
6 SASI_Hs02_00335129 predicted 821
7 SASI_Hs02_00335130 predicted 871
8 SASI_Hs02_00335131 predicted 762
9 SASI_Hs02_00335132 predicted 736
10 SASI_Hs02_00335133 predicted 845
11 SASI_Hs01_00107600 predicted 642
12 SASI_Hs01_00107601 predicted 218
13 SASI_Hs01_00107602 predicted 218
14 SASI_Hs01_00107603 predicted 303
15 SASI_Hs01_00107604 predicted 183
16 SASI_Hs01_00107605 predicted 321
17 SASI_Hs01_00107606 predicted 625
18 SASI_Hs01_00107607 predicted 646
19 SASI_Hs01_00107608 predicted 639
20 SASI_Hs01_00107609 predicted 175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219548 predicted 577
2 SASI_Rn02_00219549 predicted 529
3 SASI_Rn02_00219550 predicted 279
4 SASI_Rn02_00219551 predicted 564
5 SASI_Rn02_00219552 predicted 490
6 SASI_Rn02_00219553 predicted 451
7 SASI_Rn02_00219554 predicted 400
8 SASI_Rn02_00219555 predicted 312
9 SASI_Rn02_00219556 predicted 317
10 SASI_Rn02_00219557 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183706 predicted 477
2 SASI_Mm01_00183707 predicted 313
3 SASI_Mm01_00183708 predicted 423
4 SASI_Mm01_00183709 predicted 417
5 SASI_Mm02_00315766 predicted 461
6 SASI_Mm01_00183711 predicted 387
7 SASI_Mm01_00183712 predicted 291
8 SASI_Mm01_00183713 predicted 296
9 SASI_Mm01_00183714 predicted 296
10 SASI_Mm01_00183715 predicted 308
11 SASI_Mm01_00183710 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003134
SRP14 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 14kDa (homologous Alu RNA binding protein)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003134.4-176s21c1
Sequence:CCGGGTCGAACCAAACCCATTCCAACTCGAGTTGGAATGGGTTTGGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003134.4-584s21c1
Sequence:CCGGCACATAAGATTAGGGTCCTTTCTCGAGAAAGGACCCTAATCTTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003134.4-327s21c1
Sequence:CCGGCCTCCTTAGAGCTAACATGGACTCGAGTCCATGTTAGCTCTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003134.4-607s21c1
Sequence:CCGGGAAAGAATAGTTGCAGTGTTTCTCGAGAAACACTGCAACTATTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-328s1c1
Sequence:CCGGCCTCCTTAGAGCTAACATGGACTCGAGTCCATGTTAGCTCTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-144s1c1
Sequence:CCGGGCAGCGTCTATATCACCTTGACTCGAGTCAAGGTGATATAGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-177s1c1
Sequence:CCGGGTCGAACCAAACCCATTCCAACTCGAGTTGGAATGGGTTTGGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003134.2-585s1c1
Sequence:CCGGCACATAAGATTAGGGTCCTTTCTCGAGAAAGGACCCTAATCTTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003134.2-608s1c1
Sequence:CCGGGAAAGAATAGTTGCAGTGTTTCTCGAGAAACACTGCAACTATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-227s1c1
Sequence:CCGGGCAGACAACAAGTGTCTGTTACTCGAGTAACAGACACTTGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-226s1c1
Sequence:CCGGCGCAGACAACAAGTGTCTGTTCTCGAGAACAGACACTTGTTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-284s1c1
Sequence:CCGGGTGAGCTCCAAGGAAGTGAATCTCGAGATTCACTTCCTTGGAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003134
SRP14 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 14kDa (homologous Alu RNA binding protein)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003134.4-176s21c1
Sequence:CCGGGTCGAACCAAACCCATTCCAACTCGAGTTGGAATGGGTTTGGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003134.4-584s21c1
Sequence:CCGGCACATAAGATTAGGGTCCTTTCTCGAGAAAGGACCCTAATCTTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003134.4-327s21c1
Sequence:CCGGCCTCCTTAGAGCTAACATGGACTCGAGTCCATGTTAGCTCTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003134.4-607s21c1
Sequence:CCGGGAAAGAATAGTTGCAGTGTTTCTCGAGAAACACTGCAACTATTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-328s1c1
Sequence:CCGGCCTCCTTAGAGCTAACATGGACTCGAGTCCATGTTAGCTCTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-144s1c1
Sequence:CCGGGCAGCGTCTATATCACCTTGACTCGAGTCAAGGTGATATAGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-177s1c1
Sequence:CCGGGTCGAACCAAACCCATTCCAACTCGAGTTGGAATGGGTTTGGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003134.2-585s1c1
Sequence:CCGGCACATAAGATTAGGGTCCTTTCTCGAGAAAGGACCCTAATCTTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003134.2-608s1c1
Sequence:CCGGGAAAGAATAGTTGCAGTGTTTCTCGAGAAACACTGCAACTATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-227s1c1
Sequence:CCGGGCAGACAACAAGTGTCTGTTACTCGAGTAACAGACACTTGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-226s1c1
Sequence:CCGGCGCAGACAACAAGTGTCTGTTCTCGAGAACAGACACTTGTTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-284s1c1
Sequence:CCGGGTGAGCTCCAAGGAAGTGAATCTCGAGATTCACTTCCTTGGAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003134
SRP14 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 14kDa (homologous Alu RNA binding protein)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003134.4-176s21c1
Sequence:CCGGGTCGAACCAAACCCATTCCAACTCGAGTTGGAATGGGTTTGGTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003134.4-584s21c1
Sequence:CCGGCACATAAGATTAGGGTCCTTTCTCGAGAAAGGACCCTAATCTTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003134.4-327s21c1
Sequence:CCGGCCTCCTTAGAGCTAACATGGACTCGAGTCCATGTTAGCTCTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003134.4-607s21c1
Sequence:CCGGGAAAGAATAGTTGCAGTGTTTCTCGAGAAACACTGCAACTATTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-328s1c1
Sequence:CCGGCCTCCTTAGAGCTAACATGGACTCGAGTCCATGTTAGCTCTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-144s1c1
Sequence:CCGGGCAGCGTCTATATCACCTTGACTCGAGTCAAGGTGATATAGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-177s1c1
Sequence:CCGGGTCGAACCAAACCCATTCCAACTCGAGTTGGAATGGGTTTGGTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003134.2-585s1c1
Sequence:CCGGCACATAAGATTAGGGTCCTTTCTCGAGAAAGGACCCTAATCTTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003134.2-608s1c1
Sequence:CCGGGAAAGAATAGTTGCAGTGTTTCTCGAGAAACACTGCAACTATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-227s1c1
Sequence:CCGGGCAGACAACAAGTGTCTGTTACTCGAGTAACAGACACTTGTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-226s1c1
Sequence:CCGGCGCAGACAACAAGTGTCTGTTCTCGAGAACAGACACTTGTTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003134.2-284s1c1
Sequence:CCGGGTGAGCTCCAAGGAAGTGAATCTCGAGATTCACTTCCTTGGAGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009273
VALIDATED
SRP14 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 14kDa (homologous Alu RNA binding protein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009273.4-476s21c1
Sequence:CCGGGCACCTCTGTATGTAACTGTTCTCGAGAACAGTTACATACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-320s21c1
Sequence:CCGGCAGATGGCCTATTCAAATCTACTCGAGTAGATTTGAATAGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-157s21c1
Sequence:CCGGCGTGTTCATCACCCTCAAGAACTCGAGTTCTTGAGGGTGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-304s21c1
Sequence:CCGGAGAAGTGAACAAGTTTCAGATCTCGAGATCTGAAACTTGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-382s21c1
Sequence:CCGGGAACAAGAGTAAGAAGAGCAACTCGAGTTGCTCTTCTTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-452s1c1
Sequence:CCGGGCACCTCTGTATGTAACTGTTCTCGAGAACAGTTACATACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-358s1c1
Sequence:CCGGGAACAAGAGTAAGAAGAGCAACTCGAGTTGCTCTTCTTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-133s1c1
Sequence:CCGGCGTGTTCATCACCCTCAAGAACTCGAGTTCTTGAGGGTGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-296s1c1
Sequence:CCGGCAGATGGCCTATTCAAATCTACTCGAGTAGATTTGAATAGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-280s1c1
Sequence:CCGGAGAAGTGAACAAGTTTCAGATCTCGAGATCTGAAACTTGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009273
VALIDATED
SRP14 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 14kDa (homologous Alu RNA binding protein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009273.4-476s21c1
Sequence:CCGGGCACCTCTGTATGTAACTGTTCTCGAGAACAGTTACATACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-320s21c1
Sequence:CCGGCAGATGGCCTATTCAAATCTACTCGAGTAGATTTGAATAGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-157s21c1
Sequence:CCGGCGTGTTCATCACCCTCAAGAACTCGAGTTCTTGAGGGTGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-304s21c1
Sequence:CCGGAGAAGTGAACAAGTTTCAGATCTCGAGATCTGAAACTTGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-382s21c1
Sequence:CCGGGAACAAGAGTAAGAAGAGCAACTCGAGTTGCTCTTCTTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-452s1c1
Sequence:CCGGGCACCTCTGTATGTAACTGTTCTCGAGAACAGTTACATACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-358s1c1
Sequence:CCGGGAACAAGAGTAAGAAGAGCAACTCGAGTTGCTCTTCTTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-133s1c1
Sequence:CCGGCGTGTTCATCACCCTCAAGAACTCGAGTTCTTGAGGGTGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-296s1c1
Sequence:CCGGCAGATGGCCTATTCAAATCTACTCGAGTAGATTTGAATAGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-280s1c1
Sequence:CCGGAGAAGTGAACAAGTTTCAGATCTCGAGATCTGAAACTTGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009273
VALIDATED
SRP14 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 14kDa (homologous Alu RNA binding protein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009273.4-476s21c1
Sequence:CCGGGCACCTCTGTATGTAACTGTTCTCGAGAACAGTTACATACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-320s21c1
Sequence:CCGGCAGATGGCCTATTCAAATCTACTCGAGTAGATTTGAATAGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-157s21c1
Sequence:CCGGCGTGTTCATCACCCTCAAGAACTCGAGTTCTTGAGGGTGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-304s21c1
Sequence:CCGGAGAAGTGAACAAGTTTCAGATCTCGAGATCTGAAACTTGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009273.4-382s21c1
Sequence:CCGGGAACAAGAGTAAGAAGAGCAACTCGAGTTGCTCTTCTTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-452s1c1
Sequence:CCGGGCACCTCTGTATGTAACTGTTCTCGAGAACAGTTACATACAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-358s1c1
Sequence:CCGGGAACAAGAGTAAGAAGAGCAACTCGAGTTGCTCTTCTTACTCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-133s1c1
Sequence:CCGGCGTGTTCATCACCCTCAAGAACTCGAGTTCTTGAGGGTGATGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-296s1c1
Sequence:CCGGCAGATGGCCTATTCAAATCTACTCGAGTAGATTTGAATAGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009273.2-280s1c1
Sequence:CCGGAGAAGTGAACAAGTTTCAGATCTCGAGATCTGAAACTTGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks