EMAIL THIS PAGE TO A FRIEND

SRP19

signal recognition particle 19kDa

UniProtKB ID: P09132, B2R4E9, D6RCQ5, Q05D77, Q96FG6
Gene ID:
Mouse(66384) signal recognition particle 19
Rat(291685) signal recognition particle 19
fruit fly(38815) Signal recognition particle protein 19
Zebrafish(406652) signal recognition particle 19
domestic cat(101096538) signal recognition particle 19kDa
dog(606764) signal recognition particle 19kDa
chicken(770061) signal recognition particle 19kDa
cow(514960) signal recognition particle 19kDa
sheep(101104068) signal recognition particle 19kDa
naked mole-rat(101705850) signal recognition particle 19kDa
domestic guinea pig(100724715) signal recognition particle 19kDa
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003135 Rosetta Predictions human pricing
NM_001106157 Rosetta Predictions rat pricing
NM_025527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128401 predicted 240
2 SASI_Hs01_00128402 predicted 224
3 SASI_Hs01_00128403 predicted 225
4 SASI_Hs01_00128404 predicted 210
5 SASI_Hs01_00128405 predicted 224
6 SASI_Hs01_00128406 predicted 240
7 SASI_Hs01_00128407 predicted 246
8 SASI_Hs01_00128408 predicted 214
9 SASI_Hs01_00128409 predicted 241
10 SASI_Hs01_00128410 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216188 predicted 458
2 SASI_Rn02_00216189 predicted 219
3 SASI_Rn02_00216190 predicted 302
4 SASI_Rn02_00216191 predicted 318
5 SASI_Rn02_00216192 predicted 250
6 SASI_Rn02_00216193 predicted 440
7 SASI_Rn02_00216194 predicted 209
8 SASI_Rn02_00216195 predicted 494
9 SASI_Rn02_00216196 predicted 225
10 SASI_Rn02_00216197 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328439 predicted 551
2 SASI_Mm02_00328440 predicted 197
3 SASI_Mm02_00328441 predicted 526
4 SASI_Mm01_00157455 predicted 595
5 SASI_Mm02_00328442 predicted 198
6 SASI_Mm01_00157456 predicted 288
7 SASI_Mm02_00328443 predicted 626
8 SASI_Mm01_00157458 predicted 355
9 SASI_Mm02_00328444 predicted 204
10 SASI_Mm01_00157460 predicted 635
11 SASI_Mm01_00157454 predicted 209
12 SASI_Mm01_00157457 predicted 345
13 SASI_Mm01_00157459 predicted 346
14 SASI_Mm01_00157461 predicted 361
15 SASI_Mm01_00157462 predicted 266
16 SASI_Mm01_00157463 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003135
VALIDATED
SRP19 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 19kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-375s1c1
Sequence:CCGGCCCATCACGTAAGTCAGTAATCTCGAGATTACTGACTTACGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003135.1-244s1c1
Sequence:CCGGGCAGTTGGACTTAACGTATTTCTCGAGAAATACGTTAAGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003135.1-657s1c1
Sequence:CCGGCGGAGTTGACAGTGAAACAAACTCGAGTTTGTTTCACTGTCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-214s1c1
Sequence:CCGGACAGCTACAGAGATTCAAGATCTCGAGATCTTGAATCTCTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-187s1c1
Sequence:CCGGCCCATAAGTAAGGCTGTTGAACTCGAGTTCAACAGCCTTACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-469s21c1
Sequence:CCGGCAACAAGGAGAGGGAAGTAAACTCGAGTTTACTTCCCTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-244s21c1
Sequence:CCGGGCAGTTGGACTTAACGTATTTCTCGAGAAATACGTTAAGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003135.1-657s21c1
Sequence:CCGGCGGAGTTGACAGTGAAACAAACTCGAGTTTGTTTCACTGTCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-131s21c1
Sequence:CCGGGTATCTATCCTGCTTATTTAACTCGAGTTAAATAAGCAGGATAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-109s21c1
Sequence:CCGGGCCGACCAGGACAGGTTTATTCTCGAGAATAAACCTGTCCTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003135
VALIDATED
SRP19 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 19kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-375s1c1
Sequence:CCGGCCCATCACGTAAGTCAGTAATCTCGAGATTACTGACTTACGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003135.1-244s1c1
Sequence:CCGGGCAGTTGGACTTAACGTATTTCTCGAGAAATACGTTAAGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003135.1-657s1c1
Sequence:CCGGCGGAGTTGACAGTGAAACAAACTCGAGTTTGTTTCACTGTCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-214s1c1
Sequence:CCGGACAGCTACAGAGATTCAAGATCTCGAGATCTTGAATCTCTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-187s1c1
Sequence:CCGGCCCATAAGTAAGGCTGTTGAACTCGAGTTCAACAGCCTTACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-469s21c1
Sequence:CCGGCAACAAGGAGAGGGAAGTAAACTCGAGTTTACTTCCCTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-244s21c1
Sequence:CCGGGCAGTTGGACTTAACGTATTTCTCGAGAAATACGTTAAGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003135.1-657s21c1
Sequence:CCGGCGGAGTTGACAGTGAAACAAACTCGAGTTTGTTTCACTGTCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-131s21c1
Sequence:CCGGGTATCTATCCTGCTTATTTAACTCGAGTTAAATAAGCAGGATAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-109s21c1
Sequence:CCGGGCCGACCAGGACAGGTTTATTCTCGAGAATAAACCTGTCCTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003135
VALIDATED
SRP19 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 19kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-375s1c1
Sequence:CCGGCCCATCACGTAAGTCAGTAATCTCGAGATTACTGACTTACGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003135.1-244s1c1
Sequence:CCGGGCAGTTGGACTTAACGTATTTCTCGAGAAATACGTTAAGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003135.1-657s1c1
Sequence:CCGGCGGAGTTGACAGTGAAACAAACTCGAGTTTGTTTCACTGTCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-214s1c1
Sequence:CCGGACAGCTACAGAGATTCAAGATCTCGAGATCTTGAATCTCTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003135.1-187s1c1
Sequence:CCGGCCCATAAGTAAGGCTGTTGAACTCGAGTTCAACAGCCTTACTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-469s21c1
Sequence:CCGGCAACAAGGAGAGGGAAGTAAACTCGAGTTTACTTCCCTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-244s21c1
Sequence:CCGGGCAGTTGGACTTAACGTATTTCTCGAGAAATACGTTAAGTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003135.1-657s21c1
Sequence:CCGGCGGAGTTGACAGTGAAACAAACTCGAGTTTGTTTCACTGTCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-131s21c1
Sequence:CCGGGTATCTATCCTGCTTATTTAACTCGAGTTAAATAAGCAGGATAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003135.1-109s21c1
Sequence:CCGGGCCGACCAGGACAGGTTTATTCTCGAGAATAAACCTGTCCTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025527
SRP19 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 19kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025527.1-668s1c1
Sequence:CCGGGTGTGGAAGAAAGAAGAATATCTCGAGATATTCTTCTTTCTTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-174s1c1
Sequence:CCGGGCTACTGAGATTCAAGATGTACTCGAGTACATCTTGAATCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-350s1c1
Sequence:CCGGGATGCTATATGTAGCAGAAATCTCGAGATTTCTGCTACATATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-363s1c1
Sequence:CCGGGCAGAAATGATACCCAAGCTACTCGAGTAGCTTGGGTATCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-143s1c1
Sequence:CCGGCCCTATAAGTAAGGCTGTAGACTCGAGTCTACAGCCTTACTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025527
SRP19 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 19kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025527.1-668s1c1
Sequence:CCGGGTGTGGAAGAAAGAAGAATATCTCGAGATATTCTTCTTTCTTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-174s1c1
Sequence:CCGGGCTACTGAGATTCAAGATGTACTCGAGTACATCTTGAATCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-350s1c1
Sequence:CCGGGATGCTATATGTAGCAGAAATCTCGAGATTTCTGCTACATATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-363s1c1
Sequence:CCGGGCAGAAATGATACCCAAGCTACTCGAGTAGCTTGGGTATCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-143s1c1
Sequence:CCGGCCCTATAAGTAAGGCTGTAGACTCGAGTCTACAGCCTTACTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025527
SRP19 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 19kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025527.1-668s1c1
Sequence:CCGGGTGTGGAAGAAAGAAGAATATCTCGAGATATTCTTCTTTCTTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-174s1c1
Sequence:CCGGGCTACTGAGATTCAAGATGTACTCGAGTACATCTTGAATCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-350s1c1
Sequence:CCGGGATGCTATATGTAGCAGAAATCTCGAGATTTCTGCTACATATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-363s1c1
Sequence:CCGGGCAGAAATGATACCCAAGCTACTCGAGTAGCTTGGGTATCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025527.1-143s1c1
Sequence:CCGGCCCTATAAGTAAGGCTGTAGACTCGAGTCTACAGCCTTACTTATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks