EMAIL THIS PAGE TO A FRIEND

SRP54

signal recognition particle 54kDa

UniProtKB ID: P61011, B2R759, B4DUW6, P13624
Gene ID:
Rat(116650) signal recognition particle 54A
fruit fly(34312) CG4602 gene product from transcript CG4602-RA
Zebrafish(393963) signal recognition particle 54
dog(403953) signal recognition particle 54kDa
domestic cat(101089523) signal recognition particle 54kDa
Horse(100050647) signal recognition particle 54kDa
chicken(423322) signal recognition particle 54kDa
domestic guinea pig(100714215) signal recognition particle 54kDa
naked mole-rat(101712361) signal recognition particle 54kDa
Domestic Rabbit(100355886) signal recognition particle 54kDa
cow(614017) signal recognition particle 54kDa
sheep(101118904) signal recognition particle 54kDa
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003136 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008571 MISSION® esiRNA esiRNA targeting human SRP54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003136 Rosetta Predictions human pricing
NM_053871 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085553 predicted 1169
2 SASI_Hs01_00085554 predicted 525
3 SASI_Hs02_00335134 predicted 664
4 SASI_Hs01_00085555 predicted 603
5 SASI_Hs01_00085556 predicted 1181
6 SASI_Hs01_00085557 predicted 1498
7 SASI_Hs02_00335135 predicted 736
8 SASI_Hs01_00085559 predicted 334
9 SASI_Hs01_00085560 predicted 282
10 SASI_Hs01_00085561 predicted 1211
11 SASI_Hs01_00085558 predicted 852
12 SASI_Hs01_00085562 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119522 predicted 476
2 SASI_Rn02_00266764 predicted 1495
3 SASI_Rn01_00119523 predicted 1214
4 SASI_Rn01_00119524 predicted 1142
5 SASI_Rn01_00119525 predicted 564
6 SASI_Rn02_00266765 predicted 1732
7 SASI_Rn01_00119526 predicted 858
8 SASI_Rn01_00119527 predicted 716
9 SASI_Rn01_00119528 predicted 542
10 SASI_Rn01_00119529 predicted 1509
11 SASI_Rn01_00119530 predicted 1737
12 SASI_Rn01_00119531 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003136
VALIDATED
SRP54 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 54kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-739s21c1
Sequence:CCGGCTTCTGAAGGAGTAGAGAAATCTCGAGATTTCTCTACTCCTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1212s21c1
Sequence:CCGGCGAGACATGTATGAGCAATTTCTCGAGAAATTGCTCATACATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1903s21c1
Sequence:CCGGCCTTCTTTCCTCCCTTTAATACTCGAGTATTAAAGGGAGGAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1839s21c1
Sequence:CCGGCTTGCTTATCATGCACTCTTTCTCGAGAAAGAGTGCATGATAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-849s21c1
Sequence:CCGGGCTAATGCTATACAACCTGATCTCGAGATCAGGTTGTATAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-1903s1c1
Sequence:CCGGCCTTCTTTCCTCCCTTTAATACTCGAGTATTAAAGGGAGGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003136.2-839s1c1
Sequence:CCGGGCTTCAAGTTGCTAATGCTATCTCGAGATAGCATTAGCAACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-1839s1c1
Sequence:CCGGCTTGCTTATCATGCACTCTTTCTCGAGAAAGAGTGCATGATAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003136.2-1212s1c1
Sequence:CCGGCGAGACATGTATGAGCAATTTCTCGAGAAATTGCTCATACATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003136.2-849s1c1
Sequence:CCGGGCTAATGCTATACAACCTGATCTCGAGATCAGGTTGTATAGCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-739s1c1
Sequence:CCGGCTTCTGAAGGAGTAGAGAAATCTCGAGATTTCTCTACTCCTTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003136
VALIDATED
SRP54 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 54kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-739s21c1
Sequence:CCGGCTTCTGAAGGAGTAGAGAAATCTCGAGATTTCTCTACTCCTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1212s21c1
Sequence:CCGGCGAGACATGTATGAGCAATTTCTCGAGAAATTGCTCATACATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1903s21c1
Sequence:CCGGCCTTCTTTCCTCCCTTTAATACTCGAGTATTAAAGGGAGGAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1839s21c1
Sequence:CCGGCTTGCTTATCATGCACTCTTTCTCGAGAAAGAGTGCATGATAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-849s21c1
Sequence:CCGGGCTAATGCTATACAACCTGATCTCGAGATCAGGTTGTATAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-1903s1c1
Sequence:CCGGCCTTCTTTCCTCCCTTTAATACTCGAGTATTAAAGGGAGGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003136.2-839s1c1
Sequence:CCGGGCTTCAAGTTGCTAATGCTATCTCGAGATAGCATTAGCAACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-1839s1c1
Sequence:CCGGCTTGCTTATCATGCACTCTTTCTCGAGAAAGAGTGCATGATAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003136.2-1212s1c1
Sequence:CCGGCGAGACATGTATGAGCAATTTCTCGAGAAATTGCTCATACATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003136.2-849s1c1
Sequence:CCGGGCTAATGCTATACAACCTGATCTCGAGATCAGGTTGTATAGCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-739s1c1
Sequence:CCGGCTTCTGAAGGAGTAGAGAAATCTCGAGATTTCTCTACTCCTTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003136
VALIDATED
SRP54 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 54kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-739s21c1
Sequence:CCGGCTTCTGAAGGAGTAGAGAAATCTCGAGATTTCTCTACTCCTTCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1212s21c1
Sequence:CCGGCGAGACATGTATGAGCAATTTCTCGAGAAATTGCTCATACATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1903s21c1
Sequence:CCGGCCTTCTTTCCTCCCTTTAATACTCGAGTATTAAAGGGAGGAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278302    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-1839s21c1
Sequence:CCGGCTTGCTTATCATGCACTCTTTCTCGAGAAAGAGTGCATGATAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003136.2-849s21c1
Sequence:CCGGGCTAATGCTATACAACCTGATCTCGAGATCAGGTTGTATAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-1903s1c1
Sequence:CCGGCCTTCTTTCCTCCCTTTAATACTCGAGTATTAAAGGGAGGAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003136.2-839s1c1
Sequence:CCGGGCTTCAAGTTGCTAATGCTATCTCGAGATAGCATTAGCAACTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146835    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-1839s1c1
Sequence:CCGGCTTGCTTATCATGCACTCTTTCTCGAGAAAGAGTGCATGATAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003136.2-1212s1c1
Sequence:CCGGCGAGACATGTATGAGCAATTTCTCGAGAAATTGCTCATACATGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003136.2-849s1c1
Sequence:CCGGGCTAATGCTATACAACCTGATCTCGAGATCAGGTTGTATAGCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003136.2-739s1c1
Sequence:CCGGCTTCTGAAGGAGTAGAGAAATCTCGAGATTTCTCTACTCCTTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks