EMAIL THIS PAGE TO A FRIEND

SRP68

signal recognition particle 68kDa

UniProtKB ID: Q9UHB9, B3KUU5, B3KWY7, G3V1U4, Q8NCJ4, Q8WUK2
Gene ID:
Human(6730) Summary: This gene encodes a subunit of the signal recognition particle (SRP). The SRP is a ribonucleoprotein complex that transports secreted and membrane proteins to the endoplasmic reticulum for processing. The complex includes a 7S RNA and six protein subunits. The encoded protein is the 68kDa component of the SRP, and forms a heterodimer with the 72kDa subunit that is required for SRP function. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and three pseudogenes of this gene are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, May 2012]
Mouse(217337) signal recognition particle 68
Rat(363707) signal recognition particle 68
naked mole-rat(101706087) signal recognition particle 68kDa
domestic guinea pig(100721562) signal recognition particle 68kDa
cow(538777) signal recognition particle 68kDa
sheep(101106535) signal recognition particle 68kDa
fruit fly(39028) Signal recognition particle protein 68
Zebrafish(446119) signal recognition particle 68
chicken(417363) signal recognition particle 68kDa
domestic cat(101083221) signal recognition particle 68kDa
dog(403952) signal recognition particle 68kDa
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014230 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146032 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146032 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146032 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014230 Rosetta Predictions human pricing
NM_001108840 Rosetta Predictions rat pricing
NM_146032 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234518 predicted 595
2 SASI_Hs02_00345257 predicted 983
3 SASI_Hs01_00234519 predicted 1104
4 SASI_Hs01_00234520 predicted 588
5 SASI_Hs01_00234521 predicted 1324
6 SASI_Hs01_00234522 predicted 1028
7 SASI_Hs01_00234523 predicted 1946
8 SASI_Hs02_00345258 predicted 1948
9 SASI_Hs01_00234524 predicted 1391
10 SASI_Hs01_00234526 predicted 396
11 SASI_Hs01_00234525 predicted 1549
12 SASI_Hs01_00234527 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242595 predicted 665
2 SASI_Rn02_00242596 predicted 2041
3 SASI_Rn02_00242597 predicted 418
4 SASI_Rn02_00242598 predicted 1551
5 SASI_Rn02_00242599 predicted 1025
6 SASI_Rn02_00242600 predicted 1575
7 SASI_Rn02_00242601 predicted 1469
8 SASI_Rn02_00242602 predicted 1477
9 SASI_Rn02_00242603 predicted 1488
10 SASI_Rn02_00242604 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162567 predicted 721
2 SASI_Mm01_00162568 predicted 1582
3 SASI_Mm01_00162569 predicted 871
4 SASI_Mm01_00162570 predicted 372
5 SASI_Mm01_00162571 predicted 794
6 SASI_Mm01_00162572 predicted 687
7 SASI_Mm01_00162573 predicted 2018
8 SASI_Mm01_00162574 predicted 2044
9 SASI_Mm01_00162575 predicted 281
10 SASI_Mm02_00341616 predicted 1014
11 SASI_Mm01_00162576 predicted 1489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014230
VALIDATED
SRP68 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 68kDa
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-952s21c1
Sequence:CCGGAGATTGACAAAGTGCGCATTTCTCGAGAAATGCGCACTTTGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-1885s21c1
Sequence:CCGGGATACATCAAGGGCATCTTTGCTCGAGCAAAGATGCCCTTGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-380s21c1
Sequence:CCGGAGAGCTTCTGACCGATAATAGCTCGAGCTATTATCGGTCAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014230.2-2336s21c1
Sequence:CCGGAGAAGTTTATCTATGACTATGCTCGAGCATAGTCATAGATAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-765s21c1
Sequence:CCGGATCCGCTATTGTGCATATAATCTCGAGATTATATGCACAATAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014230.2-2200s21c1
Sequence:CCGGTGATTGCCTTTGGTCAGTAATCTCGAGATTACTGACCAAAGGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-214s21c1
Sequence:CCGGTGGAGATTCTTCAGATTATTACTCGAGTAATAATCTGAAGAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014230.2-1979s1c1
Sequence:CCGGCCCAGCAAGTTCCATGATATTCTCGAGAATATCATGGAACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1143s1c1
Sequence:CCGGCCAGGGAAGGTGTCTAATCTTCTCGAGAAGATTAGACACCTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1311s1c1
Sequence:CCGGCGACTCTATGACATCATCTTACTCGAGTAAGATGATGTCATAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1310s1c1
Sequence:CCGGCCGACTCTATGACATCATCTTCTCGAGAAGATGATGTCATAGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014230.2-611s1c1
Sequence:CCGGCCTCTCAGGAATGCTACGTTTCTCGAGAAACGTAGCATTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014230
VALIDATED
SRP68 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 68kDa
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-952s21c1
Sequence:CCGGAGATTGACAAAGTGCGCATTTCTCGAGAAATGCGCACTTTGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-1885s21c1
Sequence:CCGGGATACATCAAGGGCATCTTTGCTCGAGCAAAGATGCCCTTGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-380s21c1
Sequence:CCGGAGAGCTTCTGACCGATAATAGCTCGAGCTATTATCGGTCAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014230.2-2336s21c1
Sequence:CCGGAGAAGTTTATCTATGACTATGCTCGAGCATAGTCATAGATAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-765s21c1
Sequence:CCGGATCCGCTATTGTGCATATAATCTCGAGATTATATGCACAATAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014230.2-2200s21c1
Sequence:CCGGTGATTGCCTTTGGTCAGTAATCTCGAGATTACTGACCAAAGGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-214s21c1
Sequence:CCGGTGGAGATTCTTCAGATTATTACTCGAGTAATAATCTGAAGAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014230.2-1979s1c1
Sequence:CCGGCCCAGCAAGTTCCATGATATTCTCGAGAATATCATGGAACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1143s1c1
Sequence:CCGGCCAGGGAAGGTGTCTAATCTTCTCGAGAAGATTAGACACCTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1311s1c1
Sequence:CCGGCGACTCTATGACATCATCTTACTCGAGTAAGATGATGTCATAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1310s1c1
Sequence:CCGGCCGACTCTATGACATCATCTTCTCGAGAAGATGATGTCATAGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014230.2-611s1c1
Sequence:CCGGCCTCTCAGGAATGCTACGTTTCTCGAGAAACGTAGCATTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014230
VALIDATED
SRP68 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 68kDa
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-952s21c1
Sequence:CCGGAGATTGACAAAGTGCGCATTTCTCGAGAAATGCGCACTTTGTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-1885s21c1
Sequence:CCGGGATACATCAAGGGCATCTTTGCTCGAGCAAAGATGCCCTTGATGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-380s21c1
Sequence:CCGGAGAGCTTCTGACCGATAATAGCTCGAGCTATTATCGGTCAGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014230.2-2336s21c1
Sequence:CCGGAGAAGTTTATCTATGACTATGCTCGAGCATAGTCATAGATAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-765s21c1
Sequence:CCGGATCCGCTATTGTGCATATAATCTCGAGATTATATGCACAATAGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014230.2-2200s21c1
Sequence:CCGGTGATTGCCTTTGGTCAGTAATCTCGAGATTACTGACCAAAGGCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014230.2-214s21c1
Sequence:CCGGTGGAGATTCTTCAGATTATTACTCGAGTAATAATCTGAAGAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014230.2-1979s1c1
Sequence:CCGGCCCAGCAAGTTCCATGATATTCTCGAGAATATCATGGAACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1143s1c1
Sequence:CCGGCCAGGGAAGGTGTCTAATCTTCTCGAGAAGATTAGACACCTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1311s1c1
Sequence:CCGGCGACTCTATGACATCATCTTACTCGAGTAAGATGATGTCATAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014230.2-1310s1c1
Sequence:CCGGCCGACTCTATGACATCATCTTCTCGAGAAGATGATGTCATAGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014230.2-611s1c1
Sequence:CCGGCCTCTCAGGAATGCTACGTTTCTCGAGAAACGTAGCATTCCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146032
VALIDATED
SRP68 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 68kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146032.3-1564s21c1
Sequence:CCGGTACGACAGAGTTCTCAAATATCTCGAGATATTTGAGAACTCTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146032.3-1382s21c1
Sequence:CCGGTCCGGCTCTATGACATCATTCCTCGAGGAATGATGTCATAGAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-2044s21c1
Sequence:CCGGCCGACAAGTTCCATGGCATTACTCGAGTAATGCCATGGAACTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-287s21c1
Sequence:CCGGTGGAGATTCTGCAGATCATTACTCGAGTAATGATCTGCAGAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-842s21c1
Sequence:CCGGGCTACTGTGCATACAACATTGCTCGAGCAATGTTGTATGCACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-2044s1c1
Sequence:CCGGCCGACAAGTTCCATGGCATTACTCGAGTAATGCCATGGAACTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1721s1c1
Sequence:CCGGCTCATCAAACAGACACCTCATCTCGAGATGAGGTGTCTGTTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1953s1c1
Sequence:CCGGAGGCTACATCAAGGGCATCTTCTCGAGAAGATGCCCTTGATGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146032.3-459s1c1
Sequence:CCGGCCTGACTGATAACAGATACTTCTCGAGAAGTATCTGTTATCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1560s1c1
Sequence:CCGGCCTGTACGACAGAGTTCTCAACTCGAGTTGAGAACTCTGTCGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146032
VALIDATED
SRP68 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 68kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146032.3-1564s21c1
Sequence:CCGGTACGACAGAGTTCTCAAATATCTCGAGATATTTGAGAACTCTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146032.3-1382s21c1
Sequence:CCGGTCCGGCTCTATGACATCATTCCTCGAGGAATGATGTCATAGAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-2044s21c1
Sequence:CCGGCCGACAAGTTCCATGGCATTACTCGAGTAATGCCATGGAACTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-287s21c1
Sequence:CCGGTGGAGATTCTGCAGATCATTACTCGAGTAATGATCTGCAGAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-842s21c1
Sequence:CCGGGCTACTGTGCATACAACATTGCTCGAGCAATGTTGTATGCACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-2044s1c1
Sequence:CCGGCCGACAAGTTCCATGGCATTACTCGAGTAATGCCATGGAACTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1721s1c1
Sequence:CCGGCTCATCAAACAGACACCTCATCTCGAGATGAGGTGTCTGTTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1953s1c1
Sequence:CCGGAGGCTACATCAAGGGCATCTTCTCGAGAAGATGCCCTTGATGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146032.3-459s1c1
Sequence:CCGGCCTGACTGATAACAGATACTTCTCGAGAAGTATCTGTTATCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1560s1c1
Sequence:CCGGCCTGTACGACAGAGTTCTCAACTCGAGTTGAGAACTCTGTCGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146032
VALIDATED
SRP68 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 68kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146032.3-1564s21c1
Sequence:CCGGTACGACAGAGTTCTCAAATATCTCGAGATATTTGAGAACTCTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146032.3-1382s21c1
Sequence:CCGGTCCGGCTCTATGACATCATTCCTCGAGGAATGATGTCATAGAGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-2044s21c1
Sequence:CCGGCCGACAAGTTCCATGGCATTACTCGAGTAATGCCATGGAACTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-287s21c1
Sequence:CCGGTGGAGATTCTGCAGATCATTACTCGAGTAATGATCTGCAGAATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146032.3-842s21c1
Sequence:CCGGGCTACTGTGCATACAACATTGCTCGAGCAATGTTGTATGCACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-2044s1c1
Sequence:CCGGCCGACAAGTTCCATGGCATTACTCGAGTAATGCCATGGAACTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1721s1c1
Sequence:CCGGCTCATCAAACAGACACCTCATCTCGAGATGAGGTGTCTGTTTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1953s1c1
Sequence:CCGGAGGCTACATCAAGGGCATCTTCTCGAGAAGATGCCCTTGATGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146032.3-459s1c1
Sequence:CCGGCCTGACTGATAACAGATACTTCTCGAGAAGTATCTGTTATCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146032.3-1560s1c1
Sequence:CCGGCCTGTACGACAGAGTTCTCAACTCGAGTTGAGAACTCTGTCGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks