EMAIL THIS PAGE TO A FRIEND

SRP72

signal recognition particle 72kDa

Synonyms: BMFF
UniProtKB ID: O76094, G5E9Z8, Q7Z3C0
Gene ID:
Human(6731) Summary: This gene encodes the 72 kDa subunit of the signal recognition particle (SRP), a ribonucleoprotein complex that mediates the targeting of secretory proteins to the endoplasmic reticulum (ER). The SRP complex consists of a 7S RNA and 6 protein subunits: SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72, that are bound to the 7S RNA as monomers or heterodimers. SRP has at least 3 distinct functions that can be associated with the protein subunits: signal recognition, translational arrest, and ER membrane targeting by interaction with the docking protein. Mutations in this gene are associated with familial bone marrow failure. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(66661) signal recognition particle 72
Rat(498351) signal recognition particle 72
fruit fly(42439) Signal recognition particle protein 72
Horse(100053755) signal recognition particle 72kDa
domestic cat(101084282) signal recognition particle 72kDa
dog(403944) signal recognition particle 72kDa
chicken(422626) signal recognition particle 72kDa
Zebrafish(327335) signal recognition particle 72
cow(509430) signal recognition particle 72kDa
sheep(101109358) signal recognition particle 72kDa
domestic guinea pig(100730467) signal recognition particle 72kDa
naked mole-rat(101722196) signal recognition particle 72kDa
Domestic Rabbit(100348339) signal recognition particle 72kDa
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306768 ANTI-SRP72 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
HPA034621 Anti-SRP72 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103904 Anti-SRP72 antibody produced in rabbit affinity isolated antibody canine, rat, bovine, mouse, human, rabbit, zebrafish, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006947 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006947 Rosetta Predictions human pricing
XM_001066751 Rosetta Predictions rat pricing
XM_001066807 Rosetta Predictions rat pricing
XM_001074215 Rosetta Predictions rat pricing
XM_573584 Rosetta Predictions rat pricing
NM_025691 Rosetta Predictions mouse pricing
XM_132143 Rosetta Predictions mouse pricing
XM_896053 Rosetta Predictions mouse pricing
XM_896061 Rosetta Predictions mouse pricing
XM_896070 Rosetta Predictions mouse pricing
XM_896078 Rosetta Predictions mouse pricing
XM_896090 Rosetta Predictions mouse pricing
XM_896109 Rosetta Predictions mouse pricing
XM_974428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342665 predicted 1440
2 SASI_Hs01_00121006 predicted 1223
3 SASI_Hs01_00121007 predicted 243
4 SASI_Hs01_00121008 predicted 1290
5 SASI_Hs01_00121009 predicted 367
6 SASI_Hs01_00121010 predicted 931
7 SASI_Hs01_00121011 predicted 416
8 SASI_Hs01_00121012 predicted 895
9 SASI_Hs02_00342666 predicted 299
10 SASI_Hs02_00342667 predicted 800
11 SASI_Hs01_00121013 predicted 1227
12 SASI_Hs01_00121014 predicted 625
13 SASI_Hs01_00121015 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318622 predicted 1215
2 SASI_Rn02_00318623 predicted 227
3 SASI_Rn02_00318624 predicted 1474
4 SASI_Rn02_00318625 predicted 1647
5 SASI_Rn02_00318626 predicted 1544
6 SASI_Rn02_00318627 predicted 1381
7 SASI_Rn02_00318628 predicted 273
8 SASI_Rn02_00318629 predicted 1511
9 SASI_Rn02_00318630 predicted 896
10 SASI_Rn02_00318631 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318764 predicted 1215
2 SASI_Rn02_00318765 predicted 232
3 SASI_Rn02_00318766 predicted 2073
4 SASI_Rn02_00318767 predicted 1378
5 SASI_Rn02_00318768 predicted 271
6 SASI_Rn02_00318769 predicted 998
7 SASI_Rn02_00318770 predicted 760
8 SASI_Rn02_00318771 predicted 829
9 SASI_Rn02_00318772 predicted 895
10 SASI_Rn02_00318773 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345400 predicted 2350
2 SASI_Rn02_00345401 predicted 2225
3 SASI_Rn02_00345402 predicted 2051
4 SASI_Rn02_00345403 predicted 2353
5 SASI_Rn02_00345404 predicted 2120
6 SASI_Rn02_00345405 predicted 2510
7 SASI_Rn02_00345406 predicted 2503
8 SASI_Rn02_00345407 predicted 2162
9 SASI_Rn02_00345408 predicted 2338
10 SASI_Rn02_00345409 predicted 2160
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142321 predicted 1035
2 SASI_Rn01_00142322 predicted 231
3 SASI_Rn01_00142323 predicted 1294
4 SASI_Rn01_00142324 predicted 1604
5 SASI_Rn01_00142325 predicted 1374
6 SASI_Rn01_00142326 predicted 1203
7 SASI_Rn01_00142327 predicted 272
8 SASI_Rn01_00142328 predicted 1331
9 SASI_Rn01_00142329 predicted 1381
10 SASI_Rn01_00142330 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328843 predicted 246
2 SASI_Mm02_00328844 predicted 234
3 SASI_Mm02_00328845 predicted 271
4 SASI_Mm02_00328846 predicted 1179
5 SASI_Mm02_00328847 predicted 626
6 SASI_Mm02_00328848 predicted 2038
7 SASI_Mm02_00328849 predicted 289
8 SASI_Mm02_00328850 predicted 809
9 SASI_Mm02_00328851 predicted 1111
10 SASI_Mm02_00328852 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261854 predicted 249
2 SASI_Mm01_00261855 predicted 236
3 SASI_Mm01_00261856 predicted 280
4 SASI_Mm01_00261857 predicted 1181
5 SASI_Mm01_00261858 predicted 637
6 SASI_Mm01_00261859 predicted 2045
7 SASI_Mm01_00261860 predicted 288
8 SASI_Mm01_00261861 predicted 818
9 SASI_Mm01_00261862 predicted 1111
10 SASI_Mm01_00261863 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207985 predicted 247
2 SASI_Mm01_00207986 predicted 408
3 SASI_Mm01_00207987 predicted 245
4 SASI_Mm01_00207988 predicted 242
5 SASI_Mm01_00207989 predicted 354
6 SASI_Mm01_00207990 predicted 276
7 SASI_Mm01_00207991 predicted 219
8 SASI_Mm01_00207992 predicted 304
9 SASI_Mm01_00207993 predicted 287
10 SASI_Mm01_00207994 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245142 predicted 248
2 SASI_Mm01_00245143 predicted 245
3 SASI_Mm01_00245144 predicted 238
4 SASI_Mm01_00245145 predicted 276
5 SASI_Mm01_00245146 predicted 1186
6 SASI_Mm01_00245147 predicted 639
7 SASI_Mm01_00245148 predicted 289
8 SASI_Mm01_00245149 predicted 813
9 SASI_Mm01_00245150 predicted 1112
10 SASI_Mm01_00245151 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245192 predicted 595
2 SASI_Mm01_00245193 predicted 240
3 SASI_Mm01_00245194 predicted 773
4 SASI_Mm01_00245195 predicted 941
5 SASI_Mm01_00245196 predicted 963
6 SASI_Mm01_00245197 predicted 991
7 SASI_Mm01_00245198 predicted 541
8 SASI_Mm01_00245199 predicted 249
9 SASI_Mm01_00245200 predicted 296
10 SASI_Mm01_00245201 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240479 predicted 256
2 SASI_Mm01_00240480 predicted 409
3 SASI_Mm01_00240481 predicted 245
4 SASI_Mm01_00240482 predicted 238
5 SASI_Mm01_00240483 predicted 354
6 SASI_Mm01_00240484 predicted 275
7 SASI_Mm01_00240485 predicted 209
8 SASI_Mm01_00240486 predicted 310
9 SASI_Mm01_00240487 predicted 289
10 SASI_Mm01_00240488 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271568 predicted 1453
2 SASI_Mm01_00271569 predicted 1405
3 SASI_Mm01_00271570 predicted 1263
4 SASI_Mm01_00271571 predicted 1142
5 SASI_Mm01_00271572 predicted 1342
6 SASI_Mm01_00271573 predicted 1196
7 SASI_Mm01_00271574 predicted 1268
8 SASI_Mm01_00271575 predicted 1216
9 SASI_Mm01_00271576 predicted 1082
10 SASI_Mm01_00271577 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255815 predicted 1172
2 SASI_Mm01_00255816 predicted 1050
3 SASI_Mm01_00255817 predicted 1341
4 SASI_Mm01_00255818 predicted 1261
5 SASI_Mm01_00255819 predicted 1100
6 SASI_Mm01_00255820 predicted 1180
7 SASI_Mm01_00255821 predicted 948
8 SASI_Mm01_00255822 predicted 1116
9 SASI_Mm01_00255823 predicted 1063
10 SASI_Mm01_00255824 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212631 predicted 1621
2 SASI_Mm01_00212632 predicted 1512
3 SASI_Mm01_00212633 predicted 538
4 SASI_Mm01_00212634 predicted 1556
5 SASI_Mm01_00212635 predicted 1629
6 SASI_Mm01_00212636 predicted 1404
7 SASI_Mm01_00212637 predicted 1577
8 SASI_Mm01_00212638 predicted 1520
9 SASI_Mm01_00212639 predicted 1623
10 SASI_Mm01_00212640 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006947
VALIDATED
SRP72 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 72kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-223s1c1
Sequence:CCGGCACACCAAAGTGTTAGCCAATCTCGAGATTGGCTAACACTTTGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-1503s1c1
Sequence:CCGGGAAAGCCAAAGCTCTTAGTAACTCGAGTTACTAAGAGCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006947.2-3335s1c1
Sequence:CCGGGCTGCCTTTCTGTTTAGTAAACTCGAGTTTACTAAACAGAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-1535s1c1
Sequence:CCGGCGTCAGATAGTATGTCTCTAACTCGAGTTAGAGACATACTATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-2756s1c1
Sequence:CCGGCCATGAAAGAACTCAAGGAAACTCGAGTTTCCTTGAGTTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-1698s1c1
Sequence:CCGGGCCTAAGAATTATGACCCAAACTCGAGTTTGGGTCATAATTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-790s1c1
Sequence:CCGGGTGGGATTACTAGCTGTAATTCTCGAGAATTACAGCTAGTAATCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-152s1c1
Sequence:CCGGCCCTGCATTGTAAAGTGGTATCTCGAGATACCACTTTACAATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-2783s21c2
Sequence:CCGGCCATGAAAGAACTCAAGGAAACTCGAGTTTCCTTGAGTTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1726s21c1
Sequence:CCGGGCCTAAGAATTATGACCCAAACTCGAGTTTGGGTCATAATTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1486s21c1
Sequence:CCGGCACCCTGGCACAGCTTATTTCCTCGAGGAAATAAGCTGTGCCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-126s21c1
Sequence:CCGGGCGCTCTCAAGACCGTCAATACTCGAGTATTGACGGTCTTGAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1775s21c1
Sequence:CCGGCCAATGCGAGAACGTTCTTACCTCGAGGTAAGAACGTTCTCGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006947
VALIDATED
SRP72 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 72kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-223s1c1
Sequence:CCGGCACACCAAAGTGTTAGCCAATCTCGAGATTGGCTAACACTTTGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-1503s1c1
Sequence:CCGGGAAAGCCAAAGCTCTTAGTAACTCGAGTTACTAAGAGCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006947.2-3335s1c1
Sequence:CCGGGCTGCCTTTCTGTTTAGTAAACTCGAGTTTACTAAACAGAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-1535s1c1
Sequence:CCGGCGTCAGATAGTATGTCTCTAACTCGAGTTAGAGACATACTATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-2756s1c1
Sequence:CCGGCCATGAAAGAACTCAAGGAAACTCGAGTTTCCTTGAGTTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-1698s1c1
Sequence:CCGGGCCTAAGAATTATGACCCAAACTCGAGTTTGGGTCATAATTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-790s1c1
Sequence:CCGGGTGGGATTACTAGCTGTAATTCTCGAGAATTACAGCTAGTAATCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-152s1c1
Sequence:CCGGCCCTGCATTGTAAAGTGGTATCTCGAGATACCACTTTACAATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-2783s21c2
Sequence:CCGGCCATGAAAGAACTCAAGGAAACTCGAGTTTCCTTGAGTTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1726s21c1
Sequence:CCGGGCCTAAGAATTATGACCCAAACTCGAGTTTGGGTCATAATTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1486s21c1
Sequence:CCGGCACCCTGGCACAGCTTATTTCCTCGAGGAAATAAGCTGTGCCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-126s21c1
Sequence:CCGGGCGCTCTCAAGACCGTCAATACTCGAGTATTGACGGTCTTGAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1775s21c1
Sequence:CCGGCCAATGCGAGAACGTTCTTACCTCGAGGTAAGAACGTTCTCGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006947
VALIDATED
SRP72 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 72kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-223s1c1
Sequence:CCGGCACACCAAAGTGTTAGCCAATCTCGAGATTGGCTAACACTTTGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-1503s1c1
Sequence:CCGGGAAAGCCAAAGCTCTTAGTAACTCGAGTTACTAAGAGCTTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006947.2-3335s1c1
Sequence:CCGGGCTGCCTTTCTGTTTAGTAAACTCGAGTTTACTAAACAGAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-1535s1c1
Sequence:CCGGCGTCAGATAGTATGTCTCTAACTCGAGTTAGAGACATACTATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-2756s1c1
Sequence:CCGGCCATGAAAGAACTCAAGGAAACTCGAGTTTCCTTGAGTTCTTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-1698s1c1
Sequence:CCGGGCCTAAGAATTATGACCCAAACTCGAGTTTGGGTCATAATTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006947.2-790s1c1
Sequence:CCGGGTGGGATTACTAGCTGTAATTCTCGAGAATTACAGCTAGTAATCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006947.2-152s1c1
Sequence:CCGGCCCTGCATTGTAAAGTGGTATCTCGAGATACCACTTTACAATGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-2783s21c2
Sequence:CCGGCCATGAAAGAACTCAAGGAAACTCGAGTTTCCTTGAGTTCTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1726s21c1
Sequence:CCGGGCCTAAGAATTATGACCCAAACTCGAGTTTGGGTCATAATTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1486s21c1
Sequence:CCGGCACCCTGGCACAGCTTATTTCCTCGAGGAAATAAGCTGTGCCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-126s21c1
Sequence:CCGGGCGCTCTCAAGACCGTCAATACTCGAGTATTGACGGTCTTGAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006947.3-1775s21c1
Sequence:CCGGCCAATGCGAGAACGTTCTTACCTCGAGGTAAGAACGTTCTCGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025691
VALIDATED
SRP72 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 72kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-1466s21c1
Sequence:CCGGTCACACCCTAGCCCAACTTATCTCGAGATAAGTTGGGCTAGGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-2275s21c1
Sequence:CCGGCTAAGGTTTCCCGGGATTTAACTCGAGTTAAATCCCGGGAAACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025691.1-1758s21c1
Sequence:CCGGCCAATGCGAGAGCGCTCTTATCTCGAGATAAGAGCGCTCTCGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-633s21c1
Sequence:CCGGGATCTTTGTCGCCGTTCATTTCTCGAGAAATGAACGGCGACAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-800s21c1
Sequence:CCGGTGTGGCACTTCTCGCTGTAATCTCGAGATTACAGCGAGAAGTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025691
VALIDATED
SRP72 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 72kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-1466s21c1
Sequence:CCGGTCACACCCTAGCCCAACTTATCTCGAGATAAGTTGGGCTAGGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-2275s21c1
Sequence:CCGGCTAAGGTTTCCCGGGATTTAACTCGAGTTAAATCCCGGGAAACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025691.1-1758s21c1
Sequence:CCGGCCAATGCGAGAGCGCTCTTATCTCGAGATAAGAGCGCTCTCGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-633s21c1
Sequence:CCGGGATCTTTGTCGCCGTTCATTTCTCGAGAAATGAACGGCGACAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-800s21c1
Sequence:CCGGTGTGGCACTTCTCGCTGTAATCTCGAGATTACAGCGAGAAGTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025691
VALIDATED
SRP72 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 72kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-1466s21c1
Sequence:CCGGTCACACCCTAGCCCAACTTATCTCGAGATAAGTTGGGCTAGGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-2275s21c1
Sequence:CCGGCTAAGGTTTCCCGGGATTTAACTCGAGTTAAATCCCGGGAAACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025691.1-1758s21c1
Sequence:CCGGCCAATGCGAGAGCGCTCTTATCTCGAGATAAGAGCGCTCTCGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-633s21c1
Sequence:CCGGGATCTTTGTCGCCGTTCATTTCTCGAGAAATGAACGGCGACAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025691.1-800s21c1
Sequence:CCGGTGTGGCACTTCTCGCTGTAATCTCGAGATTACAGCGAGAAGTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks