EMAIL THIS PAGE TO A FRIEND

SRP9

signal recognition particle 9kDa

Synonyms: ALURBP
UniProtKB ID: P49458, A8K0N0, Q6NVX0, Q8WTW0
Gene ID:
Mouse(27058) signal recognition particle 9
Rat(690345) signal recognition particle 9
fruit fly(38883) Signal recognition particle protein 9
dog(611923) signal recognition particle 9kDa
domestic cat(101080935) signal recognition particle 9kDa
Zebrafish(394071) signal recognition particle 9
chicken(770243) signal recognition particle 9kDa
domestic guinea pig(100721649) signal recognition particle 9kDa
naked mole-rat(101697464) signal recognition particle 9kDa
cow(527129) signal recognition particle 9kDa
sheep(101110607) signal recognition particle 9kDa
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100986 Anti-SRP9 (1-15) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003133 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003133 Rosetta Predictions human pricing
NM_001126095 Rosetta Predictions rat pricing
NM_012058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037024 predicted 365
2 SASI_Hs01_00037025 predicted 243
3 SASI_Hs01_00037026 predicted 598
4 SASI_Hs01_00037027 predicted 606
5 SASI_Hs01_00037028 predicted 278
6 SASI_Hs01_00037029 predicted 236
7 SASI_Hs01_00037030 predicted 394
8 SASI_Hs01_00037031 predicted 437
9 SASI_Hs01_00037032 predicted 395
10 SASI_Hs01_00037033 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252963 predicted 685
2 SASI_Rn02_00252964 predicted 319
3 SASI_Rn02_00252965 predicted 461
4 SASI_Rn02_00252966 predicted 276
5 SASI_Rn02_00252967 predicted 350
6 SASI_Rn02_00252968 predicted 336
7 SASI_Rn02_00252969 predicted 525
8 SASI_Rn02_00252970 predicted 430
9 SASI_Rn02_00252971 predicted 640
10 SASI_Rn02_00252972 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322037 predicted 284
2 SASI_Mm01_00111143 predicted 357
3 SASI_Mm01_00111144 predicted 355
4 SASI_Mm01_00111145 predicted 681
5 SASI_Mm01_00111146 predicted 679
6 SASI_Mm02_00322038 predicted 376
7 SASI_Mm01_00111148 predicted 268
8 SASI_Mm01_00111149 predicted 269
9 SASI_Mm01_00111150 predicted 542
10 SASI_Mm02_00322039 predicted 338
11 SASI_Mm01_00111147 predicted 433
12 SASI_Mm01_00111151 predicted 292
13 SASI_Mm01_00111152 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012058
VALIDATED
SRP9 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 9kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-326s21c1
Sequence:CCGGAGACCAAGCGCAAGACGTAAACTCGAGTTTACGTCTTGCGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-400s21c1
Sequence:CCGGCCCGCAATGTCACTATGGAAACTCGAGTTTCCATAGTGACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-299s21c1
Sequence:CCGGTGATCTAGTTTGTTTGGTGTACTCGAGTACACCAAACAAACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-270s21c1
Sequence:CCGGGATGGGAATTTGTGTATCAAACTCGAGTTTGATACACAAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012058.2-1118s1c1
Sequence:CCGGGCTTCCTAATAAACCACAAATCTCGAGATTTGTGGTTTATTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-286s1c1
Sequence:CCGGTGATCTAGTTTGTTTGGTGTACTCGAGTACACCAAACAAACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-352s1c1
Sequence:CCGGCAGTCAGTTAATGCGACTTATCTCGAGATAAGTCGCATTAACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-257s1c1
Sequence:CCGGGATGGGAATTTGTGTATCAAACTCGAGTTTGATACACAAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-387s1c1
Sequence:CCGGCCCGCAATGTCACTATGGAAACTCGAGTTTCCATAGTGACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012058
VALIDATED
SRP9 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 9kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-326s21c1
Sequence:CCGGAGACCAAGCGCAAGACGTAAACTCGAGTTTACGTCTTGCGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-400s21c1
Sequence:CCGGCCCGCAATGTCACTATGGAAACTCGAGTTTCCATAGTGACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-299s21c1
Sequence:CCGGTGATCTAGTTTGTTTGGTGTACTCGAGTACACCAAACAAACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-270s21c1
Sequence:CCGGGATGGGAATTTGTGTATCAAACTCGAGTTTGATACACAAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012058.2-1118s1c1
Sequence:CCGGGCTTCCTAATAAACCACAAATCTCGAGATTTGTGGTTTATTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-286s1c1
Sequence:CCGGTGATCTAGTTTGTTTGGTGTACTCGAGTACACCAAACAAACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-352s1c1
Sequence:CCGGCAGTCAGTTAATGCGACTTATCTCGAGATAAGTCGCATTAACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-257s1c1
Sequence:CCGGGATGGGAATTTGTGTATCAAACTCGAGTTTGATACACAAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-387s1c1
Sequence:CCGGCCCGCAATGTCACTATGGAAACTCGAGTTTCCATAGTGACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012058
VALIDATED
SRP9 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 9kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-326s21c1
Sequence:CCGGAGACCAAGCGCAAGACGTAAACTCGAGTTTACGTCTTGCGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-400s21c1
Sequence:CCGGCCCGCAATGTCACTATGGAAACTCGAGTTTCCATAGTGACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-299s21c1
Sequence:CCGGTGATCTAGTTTGTTTGGTGTACTCGAGTACACCAAACAAACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012058.3-270s21c1
Sequence:CCGGGATGGGAATTTGTGTATCAAACTCGAGTTTGATACACAAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012058.2-1118s1c1
Sequence:CCGGGCTTCCTAATAAACCACAAATCTCGAGATTTGTGGTTTATTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-286s1c1
Sequence:CCGGTGATCTAGTTTGTTTGGTGTACTCGAGTACACCAAACAAACTAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-352s1c1
Sequence:CCGGCAGTCAGTTAATGCGACTTATCTCGAGATAAGTCGCATTAACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-257s1c1
Sequence:CCGGGATGGGAATTTGTGTATCAAACTCGAGTTTGATACACAAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012058.2-387s1c1
Sequence:CCGGCCCGCAATGTCACTATGGAAACTCGAGTTTCCATAGTGACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003133
VALIDATED
SRP9 MISSION shRNA Bacterial Glycerol Stock
signal recognition particle 9kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-1027s1c1
Sequence:CCGGGCAGCAGTTATTTGAGTGTATCTCGAGATACACTCAAATAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-339s1c1
Sequence:CCGGCCCGCAATGTTACCATGGAAACTCGAGTTTCCATGGTAACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-303s1c1
Sequence:CCGGACAGTCAACTAATGCGACTTACTCGAGTAAGTCGCATTAGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-209s1c1
Sequence:CCGGGATGGGAACTTGTGTGTTAAACTCGAGTTTAACACACAAGTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-317s1c1
Sequence:CCGGCGACTTATGGTAGCCAAGGAACTCGAGTTCCTTGGCTACCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003133
VALIDATED
SRP9 MISSION shRNA shRNA Plasmid DNA
signal recognition particle 9kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-1027s1c1
Sequence:CCGGGCAGCAGTTATTTGAGTGTATCTCGAGATACACTCAAATAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-339s1c1
Sequence:CCGGCCCGCAATGTTACCATGGAAACTCGAGTTTCCATGGTAACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-303s1c1
Sequence:CCGGACAGTCAACTAATGCGACTTACTCGAGTAAGTCGCATTAGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-209s1c1
Sequence:CCGGGATGGGAACTTGTGTGTTAAACTCGAGTTTAACACACAAGTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-317s1c1
Sequence:CCGGCGACTTATGGTAGCCAAGGAACTCGAGTTCCTTGGCTACCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003133
VALIDATED
SRP9 MISSION shRNA Lentiviral Transduction Particles
signal recognition particle 9kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-1027s1c1
Sequence:CCGGGCAGCAGTTATTTGAGTGTATCTCGAGATACACTCAAATAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-339s1c1
Sequence:CCGGCCCGCAATGTTACCATGGAAACTCGAGTTTCCATGGTAACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-303s1c1
Sequence:CCGGACAGTCAACTAATGCGACTTACTCGAGTAAGTCGCATTAGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-209s1c1
Sequence:CCGGGATGGGAACTTGTGTGTTAAACTCGAGTTTAACACACAAGTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003133.1-317s1c1
Sequence:CCGGCGACTTATGGTAGCCAAGGAACTCGAGTTCCTTGGCTACCATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks