EMAIL THIS PAGE TO A FRIEND

SRPK1

SRSF protein kinase 1

Synonyms: SFRSK1
UniProtKB ID: Q96SB4, Q12890, Q5R364, Q5R365, Q8IY12
Gene ID:
Human(6732) Summary: This gene encodes a serine/arginine protein kinase specific for the SR (serine/arginine-rich domain) family of splicing factors. The protein localizes to the nucleus and the cytoplasm. It is thought to play a role in regulation of both constitutive and alternative splicing by regulating intracellular localization of splicing factors. Alternative splicing of this gene results in multiple transcript variants. Additional alternatively spliced transcript variants have been described for this gene, but their full length nature have not been determined.[provided by RefSeq, Jul 2010]
Mouse(20815) serine/arginine-rich protein specific kinase 1
Rat(361811) SRSF protein kinase 1
chicken(421185) SFRS protein kinase 1
dog(474887) SRSF protein kinase 1
Horse(100063400) SRSF protein kinase 1
domestic cat(101100890) SRSF protein kinase 1
cow(512631) SRSF protein kinase 1
sheep(101119590) SRSF protein kinase 1
naked mole-rat(101717748) SRSF protein kinase 1
domestic guinea pig(100730101) SRSF protein kinase 1
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
12-532 SRPKtide 1 mg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003137 siRNAs that have been validated in the lab human pricing
NM_001025726 Rosetta Predictions rat pricing
NM_016795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003137 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120807 validated 468
1 SASI_Hs01_00120806 validated 1251
1 SASI_Hs01_00120808 validated 1659
2 SASI_Hs01_00120809 predicted 1362
3 SASI_Hs01_00120810 predicted 1261
4 SASI_Hs01_00120811 predicted 399
5 SASI_Hs01_00120812 predicted 1811
6 SASI_Hs01_00120813 predicted 1681
7 SASI_Hs01_00120814 predicted 1216
8 SASI_Hs01_00120815 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085932 predicted 349
2 SASI_Rn01_00085933 predicted 1746
3 SASI_Rn02_00203356 predicted 1805
4 SASI_Rn02_00203357 predicted 1557
5 SASI_Rn01_00085935 predicted 1716
6 SASI_Rn01_00085936 predicted 1144
7 SASI_Rn01_00085937 predicted 377
8 SASI_Rn01_00085939 predicted 253
9 SASI_Rn01_00085940 predicted 450
10 SASI_Rn01_00085941 predicted 503
11 SASI_Rn01_00085934 predicted 1633
12 SASI_Rn01_00085938 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054218 predicted 343
2 SASI_Mm01_00054219 predicted 1106
3 SASI_Mm01_00054220 predicted 321
4 SASI_Mm01_00054221 predicted 221
5 SASI_Mm01_00054222 predicted 1214
6 SASI_Mm02_00323575 predicted 382
7 SASI_Mm01_00054224 predicted 470
8 SASI_Mm01_00054225 predicted 352
9 SASI_Mm01_00054226 predicted 1111
10 SASI_Mm01_00054227 predicted 1583
11 SASI_Mm01_00054223 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003137
VALIDATED
SRPK1 MISSION shRNA Bacterial Glycerol Stock
SRSF protein kinase 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1990s1c1
Sequence:CCGGGCAGCTGGCTTCACAGATTTCCTCGAGGAAATCTGTGAAGCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1355s1c1
Sequence:CCGGCAGACTCTTGTACACCTATAACTCGAGTTATAGGTGTACAAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-504s1c1
Sequence:CCGGGCTGAAGTCAGTTCGCAATTCCTCGAGGAATTGCGAACTGACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1822s1c1
Sequence:CCGGGCATTGATCATAGAACTTCTGCTCGAGCAGAAGTTCTATGATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1430s1c1
Sequence:CCGGCATTCAGTGAACAACACATTACTCGAGTAATGTGTTGTTCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003137.x-2823s1c1
Sequence:CCGGCCATAACTAAAGGATCAGGATCTCGAGATCCTGATCCTTTAGTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-325s1c1
Sequence:CCGGGTGGCAATGAAAGTAGTTAAACTCGAGTTTAACTACTTTCATTGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003137.x-1324s1c1
Sequence:CCGGGAACAACACATTAGCCAACTTCTCGAGAAGTTGGCTAATGTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-410s1c1
Sequence:CCGGCAGACCCTAATGATCCAAATACTCGAGTATTTGGATCATTAGGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-840s1c1
Sequence:CCGGCCAGGCAGAATTACTAGAGAACTCGAGTTCTCTAGTAATTCTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2368s21c1
Sequence:CCGGCCCATTAGGACATCCTTTAAACTCGAGTTTAAAGGATGTCCTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-1294s21c1
Sequence:CCGGTTGAATCAGGAATCTAGTTTCCTCGAGGAAACTAGATTCCTGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2526s21c1
Sequence:CCGGATGTACAGCAGAGACATTAAACTCGAGTTTAATGTCTCTGCTGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-599s21c1
Sequence:CCGGCACATATCTGCATGGTATTTGCTCGAGCAAATACCATGCAGATATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2466s21c1
Sequence:CCGGTTTCTAGTGCATATCCTATTGCTCGAGCAATAGGATATGCACTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-1691s21c1
Sequence:CCGGTAATCGGATCTGGCTATAATACTCGAGTATTATAGCCAGATCCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003137
VALIDATED
SRPK1 MISSION shRNA shRNA Plasmid DNA
SRSF protein kinase 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1990s1c1
Sequence:CCGGGCAGCTGGCTTCACAGATTTCCTCGAGGAAATCTGTGAAGCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1355s1c1
Sequence:CCGGCAGACTCTTGTACACCTATAACTCGAGTTATAGGTGTACAAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-504s1c1
Sequence:CCGGGCTGAAGTCAGTTCGCAATTCCTCGAGGAATTGCGAACTGACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1822s1c1
Sequence:CCGGGCATTGATCATAGAACTTCTGCTCGAGCAGAAGTTCTATGATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1430s1c1
Sequence:CCGGCATTCAGTGAACAACACATTACTCGAGTAATGTGTTGTTCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003137.x-2823s1c1
Sequence:CCGGCCATAACTAAAGGATCAGGATCTCGAGATCCTGATCCTTTAGTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-325s1c1
Sequence:CCGGGTGGCAATGAAAGTAGTTAAACTCGAGTTTAACTACTTTCATTGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003137.x-1324s1c1
Sequence:CCGGGAACAACACATTAGCCAACTTCTCGAGAAGTTGGCTAATGTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-410s1c1
Sequence:CCGGCAGACCCTAATGATCCAAATACTCGAGTATTTGGATCATTAGGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-840s1c1
Sequence:CCGGCCAGGCAGAATTACTAGAGAACTCGAGTTCTCTAGTAATTCTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2368s21c1
Sequence:CCGGCCCATTAGGACATCCTTTAAACTCGAGTTTAAAGGATGTCCTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-1294s21c1
Sequence:CCGGTTGAATCAGGAATCTAGTTTCCTCGAGGAAACTAGATTCCTGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2526s21c1
Sequence:CCGGATGTACAGCAGAGACATTAAACTCGAGTTTAATGTCTCTGCTGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-599s21c1
Sequence:CCGGCACATATCTGCATGGTATTTGCTCGAGCAAATACCATGCAGATATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2466s21c1
Sequence:CCGGTTTCTAGTGCATATCCTATTGCTCGAGCAATAGGATATGCACTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-1691s21c1
Sequence:CCGGTAATCGGATCTGGCTATAATACTCGAGTATTATAGCCAGATCCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003137
VALIDATED
SRPK1 MISSION shRNA Lentiviral Transduction Particles
SRSF protein kinase 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1990s1c1
Sequence:CCGGGCAGCTGGCTTCACAGATTTCCTCGAGGAAATCTGTGAAGCCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1355s1c1
Sequence:CCGGCAGACTCTTGTACACCTATAACTCGAGTTATAGGTGTACAAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-504s1c1
Sequence:CCGGGCTGAAGTCAGTTCGCAATTCCTCGAGGAATTGCGAACTGACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1822s1c1
Sequence:CCGGGCATTGATCATAGAACTTCTGCTCGAGCAGAAGTTCTATGATCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.3-1430s1c1
Sequence:CCGGCATTCAGTGAACAACACATTACTCGAGTAATGTGTTGTTCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003137.x-2823s1c1
Sequence:CCGGCCATAACTAAAGGATCAGGATCTCGAGATCCTGATCCTTTAGTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-325s1c1
Sequence:CCGGGTGGCAATGAAAGTAGTTAAACTCGAGTTTAACTACTTTCATTGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003137.x-1324s1c1
Sequence:CCGGGAACAACACATTAGCCAACTTCTCGAGAAGTTGGCTAATGTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-410s1c1
Sequence:CCGGCAGACCCTAATGATCCAAATACTCGAGTATTTGGATCATTAGGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003137.x-840s1c1
Sequence:CCGGCCAGGCAGAATTACTAGAGAACTCGAGTTCTCTAGTAATTCTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2368s21c1
Sequence:CCGGCCCATTAGGACATCCTTTAAACTCGAGTTTAAAGGATGTCCTAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-1294s21c1
Sequence:CCGGTTGAATCAGGAATCTAGTTTCCTCGAGGAAACTAGATTCCTGATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2526s21c1
Sequence:CCGGATGTACAGCAGAGACATTAAACTCGAGTTTAATGTCTCTGCTGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-599s21c1
Sequence:CCGGCACATATCTGCATGGTATTTGCTCGAGCAAATACCATGCAGATATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003137.3-2466s21c1
Sequence:CCGGTTTCTAGTGCATATCCTATTGCTCGAGCAATAGGATATGCACTAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003137.3-1691s21c1
Sequence:CCGGTAATCGGATCTGGCTATAATACTCGAGTATTATAGCCAGATCCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016795
VALIDATED
SRPK1 MISSION shRNA Bacterial Glycerol Stock
SRSF protein kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016795.2-1587s1c1
Sequence:CCGGCCTGATAGGATCTGGCTACAACTCGAGTTGTAGCCAGATCCTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016795.2-1920s1c1
Sequence:CCGGGTTGGAGCTTATGCCTGAGAACTCGAGTTCTCAGGCATAAGCTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016795.2-223s1c1
Sequence:CCGGGACTACTGTAAAGGAGGTTATCTCGAGATAACCTCCTTTACAGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016795.2-1093s1c1
Sequence:CCGGGCGCCAGAGATTAATTGCAATCTCGAGATTGCAATTAATCTCTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-358s21c1
Sequence:CCGGGTAGCAATGAAAGTAGTTAAACTCGAGTTTAACTACTTTCATTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016795.3-2003s21c1
Sequence:CCGGCTGCAGCAGAGCTCATCATATCTCGAGATATGATGAGCTCTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-323s21c1
Sequence:CCGGTGTGGTTATCATGGGATATTCCTCGAGGAATATCCCATGATAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-1561s21c1
Sequence:CCGGACACGGCAGTATCGGTCTTTGCTCGAGCAAAGACCGATACTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016795.3-2236s21c1
Sequence:CCGGCTCTGCCCTGCCATCTTATTACTCGAGTAATAAGATGGCAGGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016795
VALIDATED
SRPK1 MISSION shRNA shRNA Plasmid DNA
SRSF protein kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016795.2-1587s1c1
Sequence:CCGGCCTGATAGGATCTGGCTACAACTCGAGTTGTAGCCAGATCCTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016795.2-1920s1c1
Sequence:CCGGGTTGGAGCTTATGCCTGAGAACTCGAGTTCTCAGGCATAAGCTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016795.2-223s1c1
Sequence:CCGGGACTACTGTAAAGGAGGTTATCTCGAGATAACCTCCTTTACAGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016795.2-1093s1c1
Sequence:CCGGGCGCCAGAGATTAATTGCAATCTCGAGATTGCAATTAATCTCTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-358s21c1
Sequence:CCGGGTAGCAATGAAAGTAGTTAAACTCGAGTTTAACTACTTTCATTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016795.3-2003s21c1
Sequence:CCGGCTGCAGCAGAGCTCATCATATCTCGAGATATGATGAGCTCTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-323s21c1
Sequence:CCGGTGTGGTTATCATGGGATATTCCTCGAGGAATATCCCATGATAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-1561s21c1
Sequence:CCGGACACGGCAGTATCGGTCTTTGCTCGAGCAAAGACCGATACTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016795.3-2236s21c1
Sequence:CCGGCTCTGCCCTGCCATCTTATTACTCGAGTAATAAGATGGCAGGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016795
VALIDATED
SRPK1 MISSION shRNA Lentiviral Transduction Particles
SRSF protein kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016795.2-1587s1c1
Sequence:CCGGCCTGATAGGATCTGGCTACAACTCGAGTTGTAGCCAGATCCTATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016795.2-1920s1c1
Sequence:CCGGGTTGGAGCTTATGCCTGAGAACTCGAGTTCTCAGGCATAAGCTCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016795.2-223s1c1
Sequence:CCGGGACTACTGTAAAGGAGGTTATCTCGAGATAACCTCCTTTACAGTAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016795.2-1093s1c1
Sequence:CCGGGCGCCAGAGATTAATTGCAATCTCGAGATTGCAATTAATCTCTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-358s21c1
Sequence:CCGGGTAGCAATGAAAGTAGTTAAACTCGAGTTTAACTACTTTCATTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016795.3-2003s21c1
Sequence:CCGGCTGCAGCAGAGCTCATCATATCTCGAGATATGATGAGCTCTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-323s21c1
Sequence:CCGGTGTGGTTATCATGGGATATTCCTCGAGGAATATCCCATGATAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016795.3-1561s21c1
Sequence:CCGGACACGGCAGTATCGGTCTTTGCTCGAGCAAAGACCGATACTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016795.3-2236s21c1
Sequence:CCGGCTCTGCCCTGCCATCTTATTACTCGAGTAATAAGATGGCAGGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks