EMAIL THIS PAGE TO A FRIEND

SRPK2

SRSF protein kinase 2

Synonyms: SFRSK2
Gene ID:
Mouse(20817) serine/arginine-rich protein specific kinase 2
Rat(296753) SRSF protein kinase 2
chicken(417711) SRSF protein kinase 2
domestic cat(101084692) SRSF protein kinase 2
Horse(100050379) SRSF protein kinase 2
dog(475894) SRSF protein kinase 2
cow(505945) SRSF protein kinase 2
sheep(101122186) SRSF protein kinase 2
domestic guinea pig(100726938) SRSF protein kinase 2
naked mole-rat(101715406) SRSF protein kinase 2
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182691 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_003138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003138 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090101 MISSION® esiRNA esiRNA human SRPK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182691 Rosetta Predictions human pricing
NM_182692 Rosetta Predictions human pricing
NM_001106575 Rosetta Predictions rat pricing
NM_009274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057789 predicted 2281
2 SASI_Hs01_00057790 predicted 1499
3 SASI_Hs02_00370858 predicted 566
4 SASI_Hs01_00057791 predicted 2076
5 SASI_Hs01_00057792 predicted 2249
6 SASI_Hs01_00057793 predicted 1440
7 SASI_Hs01_00057795 predicted 502
8 SASI_Hs01_00057796 predicted 2137
9 SASI_Hs02_00370859 predicted 2163
10 SASI_Hs01_00057797 predicted 1463
11 SASI_Hs01_00057794 predicted 1975
12 SASI_Hs01_00057798 predicted 1831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205431 predicted 2208
2 SASI_Hs01_00205432 predicted 1431
3 SASI_Hs02_00370860 predicted 503
4 SASI_Hs01_00205433 predicted 2011
5 SASI_Hs01_00205434 predicted 2182
6 SASI_Hs01_00205435 predicted 1373
7 SASI_Hs01_00205437 predicted 434
8 SASI_Hs01_00205438 predicted 2075
9 SASI_Hs02_00370861 predicted 2100
10 SASI_Hs01_00205439 predicted 1393
11 SASI_Hs01_00205436 predicted 1913
12 SASI_Hs01_00205440 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220308 predicted 2234
2 SASI_Rn02_00220309 predicted 2292
3 SASI_Rn02_00220310 predicted 570
4 SASI_Rn02_00220311 predicted 1907
5 SASI_Rn02_00220312 predicted 1261
6 SASI_Rn02_00220313 predicted 2143
7 SASI_Rn02_00220314 predicted 1957
8 SASI_Rn02_00220315 predicted 1434
9 SASI_Rn02_00220316 predicted 2126
10 SASI_Rn02_00220317 predicted 1865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315767 predicted 2266
2 SASI_Mm01_00168221 predicted 2277
3 SASI_Mm01_00168222 predicted 1661
4 SASI_Mm01_00168224 predicted 626
5 SASI_Mm01_00168225 predicted 614
6 SASI_Mm01_00168226 predicted 2147
7 SASI_Mm01_00168227 predicted 1539
8 SASI_Mm02_00315768 predicted 1978
9 SASI_Mm01_00168228 predicted 1478
10 SASI_Mm01_00168229 predicted 1877
11 SASI_Mm01_00168223 predicted 1928
12 SASI_Mm01_00168230 predicted 1831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009274
VALIDATED
SRPK2 MISSION shRNA Bacterial Glycerol Stock
SRSF protein kinase 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-2446s21c1
Sequence:CCGGTGTCTTCAGCTAAGTAGTTTACTCGAGTAAACTACTTAGCTGAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-1917s21c1
Sequence:CCGGGCTCGCCACAGGAGACTATTTCTCGAGAAATAGTCTCCTGTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-1429s21c1
Sequence:CCGGGCAAATCCCGAGGAGTATAACCTCGAGGTTATACTCCTCGGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-629s21c1
Sequence:CCGGACATGGTAGTTCAGCTAATTGCTCGAGCAATTAGCTGAACTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-2272s21c1
Sequence:CCGGTAGCATTCTGAGCTAGCAAATCTCGAGATTTGCTAGCTCAGAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009274.1-1465s1c1
Sequence:CCGGGCAGAGAGTGATTACACGTATCTCGAGATACGTGTAATCACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009274.1-619s1c1
Sequence:CCGGCCAAACAAAGACATGGTAGTTCTCGAGAACTACCATGTCTTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009274
VALIDATED
SRPK2 MISSION shRNA shRNA Plasmid DNA
SRSF protein kinase 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-2446s21c1
Sequence:CCGGTGTCTTCAGCTAAGTAGTTTACTCGAGTAAACTACTTAGCTGAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-1917s21c1
Sequence:CCGGGCTCGCCACAGGAGACTATTTCTCGAGAAATAGTCTCCTGTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-1429s21c1
Sequence:CCGGGCAAATCCCGAGGAGTATAACCTCGAGGTTATACTCCTCGGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-629s21c1
Sequence:CCGGACATGGTAGTTCAGCTAATTGCTCGAGCAATTAGCTGAACTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-2272s21c1
Sequence:CCGGTAGCATTCTGAGCTAGCAAATCTCGAGATTTGCTAGCTCAGAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009274.1-1465s1c1
Sequence:CCGGGCAGAGAGTGATTACACGTATCTCGAGATACGTGTAATCACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009274.1-619s1c1
Sequence:CCGGCCAAACAAAGACATGGTAGTTCTCGAGAACTACCATGTCTTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009274
VALIDATED
SRPK2 MISSION shRNA Lentiviral Transduction Particles
SRSF protein kinase 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-2446s21c1
Sequence:CCGGTGTCTTCAGCTAAGTAGTTTACTCGAGTAAACTACTTAGCTGAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-1917s21c1
Sequence:CCGGGCTCGCCACAGGAGACTATTTCTCGAGAAATAGTCTCCTGTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-1429s21c1
Sequence:CCGGGCAAATCCCGAGGAGTATAACCTCGAGGTTATACTCCTCGGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-629s21c1
Sequence:CCGGACATGGTAGTTCAGCTAATTGCTCGAGCAATTAGCTGAACTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009274.2-2272s21c1
Sequence:CCGGTAGCATTCTGAGCTAGCAAATCTCGAGATTTGCTAGCTCAGAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009274.1-1465s1c1
Sequence:CCGGGCAGAGAGTGATTACACGTATCTCGAGATACGTGTAATCACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009274.1-619s1c1
Sequence:CCGGCCAAACAAAGACATGGTAGTTCTCGAGAACTACCATGTCTTTGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182691
SRPK2 MISSION shRNA Bacterial Glycerol Stock
SRSF protein kinase 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-423s21c1
Sequence:CCGGGCCGGTATCATGTTATTAGAACTCGAGTTCTAATAACATGATACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-749s21c1
Sequence:CCGGCGTTGTGTGAAGAGTATCATTCTCGAGAATGATACTCTTCACACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-1418s21c1
Sequence:CCGGCCTGAGGAATATAATCTTGATCTCGAGATCAAGATTATATTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182691.1-2736s21c1
Sequence:CCGGGCACCCTGTAAATGTTACTTTCTCGAGAAAGTAACATTTACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-1919s21c1
Sequence:CCGGGCAACGGGAGATTATTTGTTTCTCGAGAAACAAATAATCTCCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182691.1-545s1c1
Sequence:CCGGGAGACAGCCTTGGATGAAATACTCGAGTATTTCATCCAAGGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182691
SRPK2 MISSION shRNA shRNA Plasmid DNA
SRSF protein kinase 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-423s21c1
Sequence:CCGGGCCGGTATCATGTTATTAGAACTCGAGTTCTAATAACATGATACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-749s21c1
Sequence:CCGGCGTTGTGTGAAGAGTATCATTCTCGAGAATGATACTCTTCACACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-1418s21c1
Sequence:CCGGCCTGAGGAATATAATCTTGATCTCGAGATCAAGATTATATTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182691.1-2736s21c1
Sequence:CCGGGCACCCTGTAAATGTTACTTTCTCGAGAAAGTAACATTTACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-1919s21c1
Sequence:CCGGGCAACGGGAGATTATTTGTTTCTCGAGAAACAAATAATCTCCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182691.1-545s1c1
Sequence:CCGGGAGACAGCCTTGGATGAAATACTCGAGTATTTCATCCAAGGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182691
SRPK2 MISSION shRNA Lentiviral Transduction Particles
SRSF protein kinase 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-423s21c1
Sequence:CCGGGCCGGTATCATGTTATTAGAACTCGAGTTCTAATAACATGATACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-749s21c1
Sequence:CCGGCGTTGTGTGAAGAGTATCATTCTCGAGAATGATACTCTTCACACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-1418s21c1
Sequence:CCGGCCTGAGGAATATAATCTTGATCTCGAGATCAAGATTATATTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182691.1-2736s21c1
Sequence:CCGGGCACCCTGTAAATGTTACTTTCTCGAGAAAGTAACATTTACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182691.1-1919s21c1
Sequence:CCGGGCAACGGGAGATTATTTGTTTCTCGAGAAACAAATAATCTCCCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182691.1-545s1c1
Sequence:CCGGGAGACAGCCTTGGATGAAATACTCGAGTATTTCATCCAAGGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003138
VALIDATED
SRPK2 MISSION shRNA Bacterial Glycerol Stock
SRSF protein kinase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-2730s1c1
Sequence:CCGGGCACCCTGTAAATGTTACTTTCTCGAGAAAGTAACATTTACAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003138.1-423s1c1
Sequence:CCGGGCCGGTATCATGTTATTAGAACTCGAGTTCTAATAACATGATACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003138.1-1415s1c1
Sequence:CCGGCCTGAGGAATATAATCTTGATCTCGAGATCAAGATTATATTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-749s1c1
Sequence:CCGGCGTTGTGTGAAGAGTATCATTCTCGAGAATGATACTCTTCACACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-1916s1c1
Sequence:CCGGGCAACGGGAGATTATTTGTTTCTCGAGAAACAAATAATCTCCCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003138
VALIDATED
SRPK2 MISSION shRNA shRNA Plasmid DNA
SRSF protein kinase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-2730s1c1
Sequence:CCGGGCACCCTGTAAATGTTACTTTCTCGAGAAAGTAACATTTACAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003138.1-423s1c1
Sequence:CCGGGCCGGTATCATGTTATTAGAACTCGAGTTCTAATAACATGATACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003138.1-1415s1c1
Sequence:CCGGCCTGAGGAATATAATCTTGATCTCGAGATCAAGATTATATTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-749s1c1
Sequence:CCGGCGTTGTGTGAAGAGTATCATTCTCGAGAATGATACTCTTCACACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-1916s1c1
Sequence:CCGGGCAACGGGAGATTATTTGTTTCTCGAGAAACAAATAATCTCCCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003138
VALIDATED
SRPK2 MISSION shRNA Lentiviral Transduction Particles
SRSF protein kinase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-2730s1c1
Sequence:CCGGGCACCCTGTAAATGTTACTTTCTCGAGAAAGTAACATTTACAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003138.1-423s1c1
Sequence:CCGGGCCGGTATCATGTTATTAGAACTCGAGTTCTAATAACATGATACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003138.1-1415s1c1
Sequence:CCGGCCTGAGGAATATAATCTTGATCTCGAGATCAAGATTATATTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-749s1c1
Sequence:CCGGCGTTGTGTGAAGAGTATCATTCTCGAGAATGATACTCTTCACACAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003138.1-1916s1c1
Sequence:CCGGGCAACGGGAGATTATTTGTTTCTCGAGAAACAAATAATCTCCCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks