EMAIL THIS PAGE TO A FRIEND

SRPK3

SRSF protein kinase 3

Synonyms: MSSK-1 MSSK1 STK23
UniProtKB ID: Q9UPE1, Q13583, Q4F970, Q562F5, Q9UM62
Gene ID:
Human(26576) Summary: This gene encodes a protein kinase similar to a protein kinase which is specific for the SR (serine/arginine-rich domain) family of splicing factors. A highly similar protein has been shown to play a role in muscle development in mice. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(56504) serine/arginine-rich protein specific kinase 3
Rat(293854) SRSF protein kinase 3
Zebrafish(566605) serine/arginine-rich protein specific kinase 3
dog(612525) SRSF protein kinase 3
Horse(100057808) SRSF protein kinase 3
naked mole-rat(101722234) SRSF protein kinase 3
Domestic Rabbit(100328742) SRSF protein kinase 3
domestic guinea pig(100727728) SRSF protein kinase 3
cow(508325) SRSF protein kinase 3
sheep(101111163) SRSF protein kinase 3
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014370 Rosetta Predictions human pricing
NM_184045 Rosetta Predictions rat pricing
NM_019684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184830 predicted 328
2 SASI_Hs01_00184831 predicted 1519
3 SASI_Hs01_00184832 predicted 443
4 SASI_Hs02_00345523 predicted 379
5 SASI_Hs01_00184833 predicted 1583
6 SASI_Hs01_00184834 predicted 1323
7 SASI_Hs01_00184835 predicted 1630
8 SASI_Hs01_00184836 predicted 457
9 SASI_Hs01_00184837 predicted 339
10 SASI_Hs01_00184838 predicted 490
11 SASI_Hs01_00184839 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040182 predicted 491
2 SASI_Rn01_00040183 predicted 228
3 SASI_Rn01_00040184 predicted 451
4 SASI_Rn01_00040185 predicted 1237
5 SASI_Rn01_00040186 predicted 504
6 SASI_Rn01_00040187 predicted 456
7 SASI_Rn01_00040188 predicted 1577
8 SASI_Rn01_00040189 predicted 1508
9 SASI_Rn01_00040190 predicted 647
10 SASI_Rn01_00040191 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045053 predicted 224
2 SASI_Mm01_00045054 predicted 630
3 SASI_Mm01_00045055 predicted 1508
4 SASI_Mm01_00045056 predicted 450
5 SASI_Mm01_00045057 predicted 498
6 SASI_Mm01_00045058 predicted 1570
7 SASI_Mm01_00045059 predicted 443
8 SASI_Mm01_00045060 predicted 637
9 SASI_Mm01_00045061 predicted 325
10 SASI_Mm01_00045062 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014370
VALIDATED
SRPK3 MISSION shRNA Bacterial Glycerol Stock
SRSF protein kinase 3
Human
27 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1135s1c1
Sequence:CCGGGCTCGTCCAATCAGCGAGAGACTCGAGTCTCTCGCTGATTGGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-798s1c1
Sequence:CCGGGAGGTCTTGCAGACCGGTAAGCTCGAGCTTACCGGTCTGCAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014370.2-542s1c1
Sequence:CCGGGCTCCTCAAATGGATCATCAACTCGAGTTGATGATCCATTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1530s1c1
Sequence:CCGGCGGGAGTTCTTCAACCGGAGACTCGAGTCTCCGGTTGAAGAACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014370.2-1890s1c1
Sequence:CCGGCGTGAGGGCTCTCGGAGAAAGCTCGAGCTTTCTCCGAGAGCCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1166s1c1
Sequence:CCGGCCTGTCGCCTAGCACACCATTCTCGAGAATGGTGTGCTAGGCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1455s1c1
Sequence:CCGGGAGGACCACATCGCTCACATACTCGAGTATGTGAGCGATGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014370.2-1867s1c1
Sequence:CCGGGAGCGTGTTCTGCCTGAGACCCTCGAGGGTCTCAGGCAGAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-630s1c1
Sequence:CCGGCCACACCAAGTGCAAGATCATCTCGAGATGATCTTGCACTTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-445s1c1
Sequence:CCGGGAGACCATTGTCCAGCTCATTCTCGAGAATGAGCTGGACAATGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-1119s1c1
Sequence:CCGGTGCAGATAAGATCAAGATCAACTCGAGTTGATCTTGATCTTATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-1525s1c1
Sequence:CCGGGCCACACAGTTCAGCGCCTTTCTCGAGAAAGGCGCTGAACTGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014370.1-1645s1c1
Sequence:CCGGCTCCAGCTCTCCGTGCCTTAACTCGAGTTAAGGCACGGAGAGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1559s21c1
Sequence:CCGGGCGGCACATCCACAATCTCAACTCGAGTTGAGATTGTGGATGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1866s21c1
Sequence:CCGGAGAGCGTGTTCTGCCTGAGACCTCGAGGTCTCAGGCAGAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1522s21c1
Sequence:CCGGGCTATTCCCGGGAGTTCTTCACTCGAGTGAAGAACTCCCGGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-454s21c1
Sequence:CCGGAGACCATTGTCCAGCTCATTGCTCGAGCAATGAGCTGGACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-553s21c1
Sequence:CCGGGGATCATCAAGTCCAACTACCCTCGAGGGTAGTTGGACTTGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1659s21c1
Sequence:CCGGCTGCCCATGATGGAGTACATCCTCGAGGATGTACTCCATCATGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1811s21c1
Sequence:CCGGCGCCAGTTCTCCACAACCACACTCGAGTGTGGTTGTGGAGAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1413s21c1
Sequence:CCGGTACCTGTTCGAGCCGCATTCTCTCGAGAGAATGCGGCTCGAACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-842s21c1
Sequence:CCGGGATGAGGCGCAAACGGAAACACTCGAGTGTTTCCGTTTGCGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-397s21c1
Sequence:GTACCGGATGAGATCAAGCTCCTGAAATCTCGAGATTTCAGGAGCTTGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1761s21c1
Sequence:CCGGCTCTCCGTGCCTTAAGGGAAACTCGAGTTTCCCTTAAGGCACGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1456s21c1
Sequence:CCGGAGGACCACATCGCTCACATAGCTCGAGCTATGTGAGCGATGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-481s21c1
Sequence:CCGGTCAGGATCTCAGGAGTCAATGCTCGAGCATTGACTCCTGAGATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014370.2-241s21c1
Sequence:CCGGAGATCGGCGACGTGTTCAATGCTCGAGCATTGAACACGTCGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014370
VALIDATED
SRPK3 MISSION shRNA shRNA Plasmid DNA
SRSF protein kinase 3
Human
27 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1135s1c1
Sequence:CCGGGCTCGTCCAATCAGCGAGAGACTCGAGTCTCTCGCTGATTGGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-798s1c1
Sequence:CCGGGAGGTCTTGCAGACCGGTAAGCTCGAGCTTACCGGTCTGCAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014370.2-542s1c1
Sequence:CCGGGCTCCTCAAATGGATCATCAACTCGAGTTGATGATCCATTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1530s1c1
Sequence:CCGGCGGGAGTTCTTCAACCGGAGACTCGAGTCTCCGGTTGAAGAACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014370.2-1890s1c1
Sequence:CCGGCGTGAGGGCTCTCGGAGAAAGCTCGAGCTTTCTCCGAGAGCCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1166s1c1
Sequence:CCGGCCTGTCGCCTAGCACACCATTCTCGAGAATGGTGTGCTAGGCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1455s1c1
Sequence:CCGGGAGGACCACATCGCTCACATACTCGAGTATGTGAGCGATGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014370.2-1867s1c1
Sequence:CCGGGAGCGTGTTCTGCCTGAGACCCTCGAGGGTCTCAGGCAGAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-630s1c1
Sequence:CCGGCCACACCAAGTGCAAGATCATCTCGAGATGATCTTGCACTTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-445s1c1
Sequence:CCGGGAGACCATTGTCCAGCTCATTCTCGAGAATGAGCTGGACAATGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-1119s1c1
Sequence:CCGGTGCAGATAAGATCAAGATCAACTCGAGTTGATCTTGATCTTATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-1525s1c1
Sequence:CCGGGCCACACAGTTCAGCGCCTTTCTCGAGAAAGGCGCTGAACTGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014370.1-1645s1c1
Sequence:CCGGCTCCAGCTCTCCGTGCCTTAACTCGAGTTAAGGCACGGAGAGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1559s21c1
Sequence:CCGGGCGGCACATCCACAATCTCAACTCGAGTTGAGATTGTGGATGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1866s21c1
Sequence:CCGGAGAGCGTGTTCTGCCTGAGACCTCGAGGTCTCAGGCAGAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1522s21c1
Sequence:CCGGGCTATTCCCGGGAGTTCTTCACTCGAGTGAAGAACTCCCGGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-454s21c1
Sequence:CCGGAGACCATTGTCCAGCTCATTGCTCGAGCAATGAGCTGGACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-553s21c1
Sequence:CCGGGGATCATCAAGTCCAACTACCCTCGAGGGTAGTTGGACTTGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1659s21c1
Sequence:CCGGCTGCCCATGATGGAGTACATCCTCGAGGATGTACTCCATCATGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1811s21c1
Sequence:CCGGCGCCAGTTCTCCACAACCACACTCGAGTGTGGTTGTGGAGAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1413s21c1
Sequence:CCGGTACCTGTTCGAGCCGCATTCTCTCGAGAGAATGCGGCTCGAACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-842s21c1
Sequence:CCGGGATGAGGCGCAAACGGAAACACTCGAGTGTTTCCGTTTGCGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-397s21c1
Sequence:GTACCGGATGAGATCAAGCTCCTGAAATCTCGAGATTTCAGGAGCTTGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1761s21c1
Sequence:CCGGCTCTCCGTGCCTTAAGGGAAACTCGAGTTTCCCTTAAGGCACGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1456s21c1
Sequence:CCGGAGGACCACATCGCTCACATAGCTCGAGCTATGTGAGCGATGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-481s21c1
Sequence:CCGGTCAGGATCTCAGGAGTCAATGCTCGAGCATTGACTCCTGAGATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014370.2-241s21c1
Sequence:CCGGAGATCGGCGACGTGTTCAATGCTCGAGCATTGAACACGTCGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014370
VALIDATED
SRPK3 MISSION shRNA Lentiviral Transduction Particles
SRSF protein kinase 3
Human
27 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1135s1c1
Sequence:CCGGGCTCGTCCAATCAGCGAGAGACTCGAGTCTCTCGCTGATTGGACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-798s1c1
Sequence:CCGGGAGGTCTTGCAGACCGGTAAGCTCGAGCTTACCGGTCTGCAAGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014370.2-542s1c1
Sequence:CCGGGCTCCTCAAATGGATCATCAACTCGAGTTGATGATCCATTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1530s1c1
Sequence:CCGGCGGGAGTTCTTCAACCGGAGACTCGAGTCTCCGGTTGAAGAACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014370.2-1890s1c1
Sequence:CCGGCGTGAGGGCTCTCGGAGAAAGCTCGAGCTTTCTCCGAGAGCCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1166s1c1
Sequence:CCGGCCTGTCGCCTAGCACACCATTCTCGAGAATGGTGTGCTAGGCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.2-1455s1c1
Sequence:CCGGGAGGACCACATCGCTCACATACTCGAGTATGTGAGCGATGTGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199786    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014370.2-1867s1c1
Sequence:CCGGGAGCGTGTTCTGCCTGAGACCCTCGAGGGTCTCAGGCAGAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-630s1c1
Sequence:CCGGCCACACCAAGTGCAAGATCATCTCGAGATGATCTTGCACTTGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-445s1c1
Sequence:CCGGGAGACCATTGTCCAGCTCATTCTCGAGAATGAGCTGGACAATGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-1119s1c1
Sequence:CCGGTGCAGATAAGATCAAGATCAACTCGAGTTGATCTTGATCTTATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014370.1-1525s1c1
Sequence:CCGGGCCACACAGTTCAGCGCCTTTCTCGAGAAAGGCGCTGAACTGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014370.1-1645s1c1
Sequence:CCGGCTCCAGCTCTCCGTGCCTTAACTCGAGTTAAGGCACGGAGAGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1559s21c1
Sequence:CCGGGCGGCACATCCACAATCTCAACTCGAGTTGAGATTGTGGATGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1866s21c1
Sequence:CCGGAGAGCGTGTTCTGCCTGAGACCTCGAGGTCTCAGGCAGAACACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1522s21c1
Sequence:CCGGGCTATTCCCGGGAGTTCTTCACTCGAGTGAAGAACTCCCGGGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-454s21c1
Sequence:CCGGAGACCATTGTCCAGCTCATTGCTCGAGCAATGAGCTGGACAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-553s21c1
Sequence:CCGGGGATCATCAAGTCCAACTACCCTCGAGGGTAGTTGGACTTGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1659s21c1
Sequence:CCGGCTGCCCATGATGGAGTACATCCTCGAGGATGTACTCCATCATGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1811s21c1
Sequence:CCGGCGCCAGTTCTCCACAACCACACTCGAGTGTGGTTGTGGAGAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1413s21c1
Sequence:CCGGTACCTGTTCGAGCCGCATTCTCTCGAGAGAATGCGGCTCGAACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-842s21c1
Sequence:CCGGGATGAGGCGCAAACGGAAACACTCGAGTGTTTCCGTTTGCGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-397s21c1
Sequence:GTACCGGATGAGATCAAGCTCCTGAAATCTCGAGATTTCAGGAGCTTGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014370.2-1761s21c1
Sequence:CCGGCTCTCCGTGCCTTAAGGGAAACTCGAGTTTCCCTTAAGGCACGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-1456s21c1
Sequence:CCGGAGGACCACATCGCTCACATAGCTCGAGCTATGTGAGCGATGTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014370.2-481s21c1
Sequence:CCGGTCAGGATCTCAGGAGTCAATGCTCGAGCATTGACTCCTGAGATCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014370.2-241s21c1
Sequence:CCGGAGATCGGCGACGTGTTCAATGCTCGAGCATTGAACACGTCGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019684
SRPK3 MISSION shRNA Bacterial Glycerol Stock
SRSF protein kinase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-1458s1c1
Sequence:CCGGGCTCATATCGTGGAACTTCTACTCGAGTAGAAGTTCCACGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-629s1c1
Sequence:CCGGCCTCCATACTAAGTGCAAGATCTCGAGATCTTGCACTTAGTATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-582s1c1
Sequence:CCGGCCCTGTGTTAAGAGCATTGTTCTCGAGAACAATGCTCTTAACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019684.1-1739s1c1
Sequence:CCGGGCTGTGGACAGTAGAGACTATCTCGAGATAGTCTCTACTGTCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-227s1c1
Sequence:CCGGCCCAGTGAAGATCGGTGATTTCTCGAGAAATCACCGATCTTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-1276s21c1
Sequence:CCGGAGCACTTCACTGAGGATATTCCTCGAGGAATATCCTCAGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-1498s21c1
Sequence:CCGGTTGCCCTCTCAGGCCGATATTCTCGAGAATATCGGCCTGAGAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-446s21c1
Sequence:CCGGGGAGACCATTGTTCAACTTATCTCGAGATAAGTTGAACAATGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019684
SRPK3 MISSION shRNA shRNA Plasmid DNA
SRSF protein kinase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-1458s1c1
Sequence:CCGGGCTCATATCGTGGAACTTCTACTCGAGTAGAAGTTCCACGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-629s1c1
Sequence:CCGGCCTCCATACTAAGTGCAAGATCTCGAGATCTTGCACTTAGTATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-582s1c1
Sequence:CCGGCCCTGTGTTAAGAGCATTGTTCTCGAGAACAATGCTCTTAACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019684.1-1739s1c1
Sequence:CCGGGCTGTGGACAGTAGAGACTATCTCGAGATAGTCTCTACTGTCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-227s1c1
Sequence:CCGGCCCAGTGAAGATCGGTGATTTCTCGAGAAATCACCGATCTTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-1276s21c1
Sequence:CCGGAGCACTTCACTGAGGATATTCCTCGAGGAATATCCTCAGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-1498s21c1
Sequence:CCGGTTGCCCTCTCAGGCCGATATTCTCGAGAATATCGGCCTGAGAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-446s21c1
Sequence:CCGGGGAGACCATTGTTCAACTTATCTCGAGATAAGTTGAACAATGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019684
SRPK3 MISSION shRNA Lentiviral Transduction Particles
SRSF protein kinase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-1458s1c1
Sequence:CCGGGCTCATATCGTGGAACTTCTACTCGAGTAGAAGTTCCACGATATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-629s1c1
Sequence:CCGGCCTCCATACTAAGTGCAAGATCTCGAGATCTTGCACTTAGTATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-582s1c1
Sequence:CCGGCCCTGTGTTAAGAGCATTGTTCTCGAGAACAATGCTCTTAACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019684.1-1739s1c1
Sequence:CCGGGCTGTGGACAGTAGAGACTATCTCGAGATAGTCTCTACTGTCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019684.1-227s1c1
Sequence:CCGGCCCAGTGAAGATCGGTGATTTCTCGAGAAATCACCGATCTTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-1276s21c1
Sequence:CCGGAGCACTTCACTGAGGATATTCCTCGAGGAATATCCTCAGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-1498s21c1
Sequence:CCGGTTGCCCTCTCAGGCCGATATTCTCGAGAATATCGGCCTGAGAGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019684.1-446s21c1
Sequence:CCGGGGAGACCATTGTTCAACTTATCTCGAGATAAGTTGAACAATGGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks