EMAIL THIS PAGE TO A FRIEND

SRPR

signal recognition particle receptor (docking protein)

Synonyms: DP Sralpha
UniProtKB ID: P08240, A6NIB3, B2R5Z8, B4E0H3, E9PJS4, Q9BVJ4
Gene ID:
Human(6734) Summary: The gene encodes a subunit of the endoplasmic reticulum signal recognition particle receptor that, in conjunction with the signal recognition particle, is involved in the targeting and translocation of signal sequence tagged secretory and membrane proteins across the endoplasmic reticulum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Mouse(67398) signal recognition particle receptor ('docking protein')
Rat(315548) signal recognition particle receptor ('docking protein')
Zebrafish(569063) signal recognition particle receptor (docking protein)
domestic cat(101087779) signal recognition particle receptor (docking protein)
dog(489293) signal recognition particle receptor (docking protein)
chicken(419713) signal recognition particle receptor (docking protein)
cow(281504) signal recognition particle receptor (docking protein)
sheep(101113709) signal recognition particle receptor (docking protein)
domestic guinea pig(100733048) signal recognition particle receptor (docking protein)
Domestic Rabbit(100344201) signal recognition particle receptor (docking protein)
naked mole-rat(101713663) signal recognition particle receptor (docking protein)
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU189451 MISSION® esiRNA esiRNA targeting mouse Srpr mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003139 Rosetta Predictions human pricing
NM_001034150 Rosetta Predictions rat pricing
NM_026130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222112 predicted 1800
2 SASI_Hs01_00222113 predicted 1686
3 SASI_Hs01_00222114 predicted 1191
4 SASI_Hs01_00222115 predicted 1249
5 SASI_Hs01_00222116 predicted 1653
6 SASI_Hs01_00222117 predicted 1396
7 SASI_Hs02_00335136 predicted 1003
8 SASI_Hs01_00222119 predicted 1112
9 SASI_Hs02_00335137 predicted 1795
10 SASI_Hs01_00222120 predicted 204
11 SASI_Hs01_00222118 predicted 1362
12 SASI_Hs01_00222121 predicted 1866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068739 predicted 862
2 SASI_Rn01_00068740 predicted 1919
3 SASI_Rn01_00068741 predicted 1307
4 SASI_Rn01_00068742 predicted 2097
5 SASI_Rn02_00204007 predicted 1202
6 SASI_Rn01_00068745 predicted 228
7 SASI_Rn01_00068746 predicted 1550
8 SASI_Rn01_00068747 predicted 1730
9 SASI_Rn01_00068748 predicted 331
10 SASI_Rn02_00204008 predicted 1895
11 SASI_Rn01_00068743 predicted 1417
12 SASI_Rn01_00068744 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049774 predicted 839
2 SASI_Mm01_00049775 predicted 1896
3 SASI_Mm01_00049776 predicted 1708
4 SASI_Mm01_00049777 predicted 1279
5 SASI_Mm02_00329717 predicted 1216
6 SASI_Mm01_00049778 predicted 2068
7 SASI_Mm02_00329718 predicted 902
8 SASI_Mm01_00049781 predicted 1424
9 SASI_Mm01_00049782 predicted 1293
10 SASI_Mm02_00329719 predicted 211
11 SASI_Mm01_00049773 predicted 1378
12 SASI_Mm01_00049779 predicted 1181
13 SASI_Mm01_00049780 predicted 1958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003139
VALIDATED
SRPR MISSION shRNA Bacterial Glycerol Stock
signal recognition particle receptor (docking protein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1681s21c1
Sequence:CCGGCCTGATTTGGTGCTGTTTGTACTCGAGTACAAACAGCACCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-202s21c1
Sequence:CCGGGCACTCACACTCAAGTATAAACTCGAGTTTATACTTGAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1657s21c1
Sequence:CCGGGCCAAACTCATTACTGTCAATCTCGAGATTGACAGTAATGAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1086s21c1
Sequence:CCGGGCGTGATCATCTCATTGCTAACTCGAGTTAGCAATGAGATGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-202s1c1
Sequence:CCGGGCACTCACACTCAAGTATAAACTCGAGTTTATACTTGAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003139.2-1657s1c1
Sequence:CCGGGCCAAACTCATTACTGTCAATCTCGAGATTGACAGTAATGAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003139.2-1086s1c1
Sequence:CCGGGCGTGATCATCTCATTGCTAACTCGAGTTAGCAATGAGATGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-1681s1c1
Sequence:CCGGCCTGATTTGGTGCTGTTTGTACTCGAGTACAAACAGCACCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-811s1c1
Sequence:CCGGGCTAACAAAGAAGTGTTGGATCTCGAGATCCAACACTTCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003139
VALIDATED
SRPR MISSION shRNA shRNA Plasmid DNA
signal recognition particle receptor (docking protein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1681s21c1
Sequence:CCGGCCTGATTTGGTGCTGTTTGTACTCGAGTACAAACAGCACCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-202s21c1
Sequence:CCGGGCACTCACACTCAAGTATAAACTCGAGTTTATACTTGAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1657s21c1
Sequence:CCGGGCCAAACTCATTACTGTCAATCTCGAGATTGACAGTAATGAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1086s21c1
Sequence:CCGGGCGTGATCATCTCATTGCTAACTCGAGTTAGCAATGAGATGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-202s1c1
Sequence:CCGGGCACTCACACTCAAGTATAAACTCGAGTTTATACTTGAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003139.2-1657s1c1
Sequence:CCGGGCCAAACTCATTACTGTCAATCTCGAGATTGACAGTAATGAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003139.2-1086s1c1
Sequence:CCGGGCGTGATCATCTCATTGCTAACTCGAGTTAGCAATGAGATGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-1681s1c1
Sequence:CCGGCCTGATTTGGTGCTGTTTGTACTCGAGTACAAACAGCACCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-811s1c1
Sequence:CCGGGCTAACAAAGAAGTGTTGGATCTCGAGATCCAACACTTCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003139
VALIDATED
SRPR MISSION shRNA Lentiviral Transduction Particles
signal recognition particle receptor (docking protein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1681s21c1
Sequence:CCGGCCTGATTTGGTGCTGTTTGTACTCGAGTACAAACAGCACCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-202s21c1
Sequence:CCGGGCACTCACACTCAAGTATAAACTCGAGTTTATACTTGAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1657s21c1
Sequence:CCGGGCCAAACTCATTACTGTCAATCTCGAGATTGACAGTAATGAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003139.2-1086s21c1
Sequence:CCGGGCGTGATCATCTCATTGCTAACTCGAGTTAGCAATGAGATGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-202s1c1
Sequence:CCGGGCACTCACACTCAAGTATAAACTCGAGTTTATACTTGAGTGTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003139.2-1657s1c1
Sequence:CCGGGCCAAACTCATTACTGTCAATCTCGAGATTGACAGTAATGAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003139.2-1086s1c1
Sequence:CCGGGCGTGATCATCTCATTGCTAACTCGAGTTAGCAATGAGATGATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-1681s1c1
Sequence:CCGGCCTGATTTGGTGCTGTTTGTACTCGAGTACAAACAGCACCAAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003139.2-811s1c1
Sequence:CCGGGCTAACAAAGAAGTGTTGGATCTCGAGATCCAACACTTCTTTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026130
VALIDATED
SRPR MISSION shRNA Bacterial Glycerol Stock
signal recognition particle receptor (docking protein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-483s21c1
Sequence:CCGGCCCACTACCATGAAGAAATTTCTCGAGAAATTTCTTCATGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-236s21c1
Sequence:CCGGGGCTCTCACACTCAAGTATAACTCGAGTTATACTTGAGTGTGAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-2365s21c1
Sequence:CCGGCCCAGCTCTAATGGCTTAATTCTCGAGAATTAAGCCATTAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-1328s21c1
Sequence:CCGGGCGCCCTTATGTTGTTACCTTCTCGAGAAGGTAACAACATAAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-1431s21c1
Sequence:CCGGATTGCTGCCTGTGATACATTTCTCGAGAAATGTATCACAGGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-2365s1c1
Sequence:CCGGCCCAGCTCTAATGGCTTAATTCTCGAGAATTAAGCCATTAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-1530s1c1
Sequence:CCGGCGTACGATGGTGCAGTTGTTTCTCGAGAAACAACTGCACCATCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026130.1-321s1c1
Sequence:CCGGGTAGACAAGTTGATAGATGATCTCGAGATCATCTATCAACTTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-483s1c1
Sequence:CCGGCCCACTACCATGAAGAAATTTCTCGAGAAATTTCTTCATGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-1328s1c1
Sequence:CCGGGCGCCCTTATGTTGTTACCTTCTCGAGAAGGTAACAACATAAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026130
VALIDATED
SRPR MISSION shRNA shRNA Plasmid DNA
signal recognition particle receptor (docking protein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-483s21c1
Sequence:CCGGCCCACTACCATGAAGAAATTTCTCGAGAAATTTCTTCATGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-236s21c1
Sequence:CCGGGGCTCTCACACTCAAGTATAACTCGAGTTATACTTGAGTGTGAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-2365s21c1
Sequence:CCGGCCCAGCTCTAATGGCTTAATTCTCGAGAATTAAGCCATTAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-1328s21c1
Sequence:CCGGGCGCCCTTATGTTGTTACCTTCTCGAGAAGGTAACAACATAAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-1431s21c1
Sequence:CCGGATTGCTGCCTGTGATACATTTCTCGAGAAATGTATCACAGGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-2365s1c1
Sequence:CCGGCCCAGCTCTAATGGCTTAATTCTCGAGAATTAAGCCATTAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-1530s1c1
Sequence:CCGGCGTACGATGGTGCAGTTGTTTCTCGAGAAACAACTGCACCATCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026130.1-321s1c1
Sequence:CCGGGTAGACAAGTTGATAGATGATCTCGAGATCATCTATCAACTTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-483s1c1
Sequence:CCGGCCCACTACCATGAAGAAATTTCTCGAGAAATTTCTTCATGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-1328s1c1
Sequence:CCGGGCGCCCTTATGTTGTTACCTTCTCGAGAAGGTAACAACATAAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026130
VALIDATED
SRPR MISSION shRNA Lentiviral Transduction Particles
signal recognition particle receptor (docking protein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-483s21c1
Sequence:CCGGCCCACTACCATGAAGAAATTTCTCGAGAAATTTCTTCATGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-236s21c1
Sequence:CCGGGGCTCTCACACTCAAGTATAACTCGAGTTATACTTGAGTGTGAGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287737    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-2365s21c1
Sequence:CCGGCCCAGCTCTAATGGCTTAATTCTCGAGAATTAAGCCATTAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-1328s21c1
Sequence:CCGGGCGCCCTTATGTTGTTACCTTCTCGAGAAGGTAACAACATAAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026130.1-1431s21c1
Sequence:CCGGATTGCTGCCTGTGATACATTTCTCGAGAAATGTATCACAGGCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-2365s1c1
Sequence:CCGGCCCAGCTCTAATGGCTTAATTCTCGAGAATTAAGCCATTAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-1530s1c1
Sequence:CCGGCGTACGATGGTGCAGTTGTTTCTCGAGAAACAACTGCACCATCGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026130.1-321s1c1
Sequence:CCGGGTAGACAAGTTGATAGATGATCTCGAGATCATCTATCAACTTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-483s1c1
Sequence:CCGGCCCACTACCATGAAGAAATTTCTCGAGAAATTTCTTCATGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026130.1-1328s1c1
Sequence:CCGGGCGCCCTTATGTTGTTACCTTCTCGAGAAGGTAACAACATAAGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks