EMAIL THIS PAGE TO A FRIEND

SRPRB

signal recognition particle receptor, B subunit

Synonyms: APMCF1
UniProtKB ID: Q9Y5M8, Q6P595, Q8N2D8
Gene ID:
Human(58477) Summary: The protein encoded by this gene has similarity to mouse protein which is a subunit of the signal recognition particle receptor (SR). This subunit is a transmembrane GTPase belonging to the GTPase superfamily. It anchors alpha subunit, a peripheral membrane GTPase, to the ER membrane. SR is required for the cotranslational targeting of both secretory and membrane proteins to the ER membrane. [provided by RefSeq, Jul 2008]
Mouse(20818) signal recognition particle receptor, B subunit
Rat(300965) signal recognition particle receptor, B subunit
naked mole-rat(101719981) signal recognition particle receptor, B subunit
domestic guinea pig(101788487) signal recognition particle receptor, B subunit
cow(100138613) signal recognition particle receptor, B subunit
sheep(101116621) signal recognition particle receptor, B subunit
Zebrafish(436845) signal recognition particle receptor, B subunit
domestic cat(101084899) signal recognition particle receptor, B subunit
dog(610826) signal recognition particle receptor, B subunit
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021203 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021203 Rosetta Predictions human pricing
NM_001013252 Rosetta Predictions rat pricing
NM_009275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162109 predicted 422
2 SASI_Hs01_00162111 predicted 501
3 SASI_Hs01_00162112 predicted 267
4 SASI_Hs01_00162114 predicted 222
5 SASI_Hs01_00162115 predicted 603
6 SASI_Hs01_00162116 predicted 521
7 SASI_Hs01_00162117 predicted 703
8 SASI_Hs02_00354791 predicted 262
9 SASI_Hs02_00354792 predicted 263
10 SASI_Hs02_00354793 predicted 428
11 SASI_Hs01_00162110 predicted 620
12 SASI_Hs01_00162113 predicted 557
13 SASI_Hs01_00162118 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201078 predicted 449
2 SASI_Rn01_00115163 predicted 448
3 SASI_Rn01_00115164 predicted 405
4 SASI_Rn01_00115165 predicted 280
5 SASI_Rn01_00115166 predicted 304
6 SASI_Rn01_00115167 predicted 382
7 SASI_Rn01_00115168 predicted 300
8 SASI_Rn01_00115169 predicted 283
9 SASI_Rn01_00115170 predicted 343
10 SASI_Rn01_00115171 predicted 199
11 SASI_Rn01_00115172 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036440 predicted 443
2 SASI_Mm01_00036441 predicted 292
3 SASI_Mm01_00036442 predicted 504
4 SASI_Mm01_00036443 predicted 711
5 SASI_Mm02_00315769 predicted 430
6 SASI_Mm01_00036444 predicted 497
7 SASI_Mm01_00036445 predicted 288
8 SASI_Mm01_00036446 predicted 381
9 SASI_Mm01_00036447 predicted 527
10 SASI_Mm01_00036448 predicted 599
11 SASI_Mm01_00036449 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021203
VALIDATED
SRPRB MISSION shRNA Bacterial Glycerol Stock
signal recognition particle receptor, B subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-548s1c1
Sequence:CCGGGCCTGCAATAAGCAAGATATTCTCGAGAATATCTTGCTTATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-470s1c1
Sequence:CCGGGTGAAAGATGTGGCTGAGTTTCTCGAGAAACTCAGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-391s1c1
Sequence:CCGGGCTTCAGTTCTTAGAGCGGTTCTCGAGAACCGCTCTAAGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-262s1c1
Sequence:CCGGCAGGTTGTTAACAGGCCTTTACTCGAGTAAAGGCCTGTTAACAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021203.2-166s1c1
Sequence:CCGGGCTAGTCTTCTGGAAGTTAATCTCGAGATTAACTTCCAGAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-262s21c1
Sequence:CCGGCAGGTTGTTAACAGGCCTTTACTCGAGTAAAGGCCTGTTAACAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-391s21c1
Sequence:CCGGGCTTCAGTTCTTAGAGCGGTTCTCGAGAACCGCTCTAAGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-470s21c1
Sequence:CCGGGTGAAAGATGTGGCTGAGTTTCTCGAGAAACTCAGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021203.2-548s21c1
Sequence:CCGGGCCTGCAATAAGCAAGATATTCTCGAGAATATCTTGCTTATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-166s21c1
Sequence:CCGGGCTAGTCTTCTGGAAGTTAATCTCGAGATTAACTTCCAGAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021203
VALIDATED
SRPRB MISSION shRNA shRNA Plasmid DNA
signal recognition particle receptor, B subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-548s1c1
Sequence:CCGGGCCTGCAATAAGCAAGATATTCTCGAGAATATCTTGCTTATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-470s1c1
Sequence:CCGGGTGAAAGATGTGGCTGAGTTTCTCGAGAAACTCAGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-391s1c1
Sequence:CCGGGCTTCAGTTCTTAGAGCGGTTCTCGAGAACCGCTCTAAGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-262s1c1
Sequence:CCGGCAGGTTGTTAACAGGCCTTTACTCGAGTAAAGGCCTGTTAACAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021203.2-166s1c1
Sequence:CCGGGCTAGTCTTCTGGAAGTTAATCTCGAGATTAACTTCCAGAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-262s21c1
Sequence:CCGGCAGGTTGTTAACAGGCCTTTACTCGAGTAAAGGCCTGTTAACAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-391s21c1
Sequence:CCGGGCTTCAGTTCTTAGAGCGGTTCTCGAGAACCGCTCTAAGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-470s21c1
Sequence:CCGGGTGAAAGATGTGGCTGAGTTTCTCGAGAAACTCAGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021203.2-548s21c1
Sequence:CCGGGCCTGCAATAAGCAAGATATTCTCGAGAATATCTTGCTTATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-166s21c1
Sequence:CCGGGCTAGTCTTCTGGAAGTTAATCTCGAGATTAACTTCCAGAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021203
VALIDATED
SRPRB MISSION shRNA Lentiviral Transduction Particles
signal recognition particle receptor, B subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-548s1c1
Sequence:CCGGGCCTGCAATAAGCAAGATATTCTCGAGAATATCTTGCTTATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-470s1c1
Sequence:CCGGGTGAAAGATGTGGCTGAGTTTCTCGAGAAACTCAGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-391s1c1
Sequence:CCGGGCTTCAGTTCTTAGAGCGGTTCTCGAGAACCGCTCTAAGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021203.2-262s1c1
Sequence:CCGGCAGGTTGTTAACAGGCCTTTACTCGAGTAAAGGCCTGTTAACAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021203.2-166s1c1
Sequence:CCGGGCTAGTCTTCTGGAAGTTAATCTCGAGATTAACTTCCAGAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-262s21c1
Sequence:CCGGCAGGTTGTTAACAGGCCTTTACTCGAGTAAAGGCCTGTTAACAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-391s21c1
Sequence:CCGGGCTTCAGTTCTTAGAGCGGTTCTCGAGAACCGCTCTAAGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-470s21c1
Sequence:CCGGGTGAAAGATGTGGCTGAGTTTCTCGAGAAACTCAGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021203.2-548s21c1
Sequence:CCGGGCCTGCAATAAGCAAGATATTCTCGAGAATATCTTGCTTATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_021203.2-166s21c1
Sequence:CCGGGCTAGTCTTCTGGAAGTTAATCTCGAGATTAACTTCCAGAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009275
VALIDATED
SRPRB MISSION shRNA Bacterial Glycerol Stock
signal recognition particle receptor, B subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009275.3-1868s1c1
Sequence:CCGGGCTGTCTTCAACATTTGTGTTCTCGAGAACACAAATGTTGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-522s1c1
Sequence:CCGGCCTTATTAATAGCCTGCAATACTCGAGTATTGCAGGCTATTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-292s1c1
Sequence:CCGGCGATAGTTCTGCCATATACAACTCGAGTTGTATATGGCAGAACTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-709s1c1
Sequence:CCGGGTTGCCACTCAAAGTGGAGTTCTCGAGAACTCCACTTTGAGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-455s1c1
Sequence:CCGGGTGAAAGATGTGGCCGAATTTCTCGAGAAATTCGGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-454s21c1
Sequence:CCGGGTGAAAGATGTGGCCGAATTTCTCGAGAAATTCGGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-708s21c1
Sequence:CCGGGTTGCCACTCAAAGTGGAGTTCTCGAGAACTCCACTTTGAGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-291s21c1
Sequence:CCGGCGATAGTTCTGCCATATACAACTCGAGTTGTATATGGCAGAACTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-1041s21c1
Sequence:CCGGTCATGTTAGTGTGAGACATAACTCGAGTTATGTCTCACACTAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-379s21c1
Sequence:CCGGCAGCTCTTAGATCGCTTTAAGCTCGAGCTTAAAGCGATCTAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009275
VALIDATED
SRPRB MISSION shRNA shRNA Plasmid DNA
signal recognition particle receptor, B subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009275.3-1868s1c1
Sequence:CCGGGCTGTCTTCAACATTTGTGTTCTCGAGAACACAAATGTTGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-522s1c1
Sequence:CCGGCCTTATTAATAGCCTGCAATACTCGAGTATTGCAGGCTATTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-292s1c1
Sequence:CCGGCGATAGTTCTGCCATATACAACTCGAGTTGTATATGGCAGAACTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-709s1c1
Sequence:CCGGGTTGCCACTCAAAGTGGAGTTCTCGAGAACTCCACTTTGAGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-455s1c1
Sequence:CCGGGTGAAAGATGTGGCCGAATTTCTCGAGAAATTCGGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-454s21c1
Sequence:CCGGGTGAAAGATGTGGCCGAATTTCTCGAGAAATTCGGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-708s21c1
Sequence:CCGGGTTGCCACTCAAAGTGGAGTTCTCGAGAACTCCACTTTGAGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-291s21c1
Sequence:CCGGCGATAGTTCTGCCATATACAACTCGAGTTGTATATGGCAGAACTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-1041s21c1
Sequence:CCGGTCATGTTAGTGTGAGACATAACTCGAGTTATGTCTCACACTAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-379s21c1
Sequence:CCGGCAGCTCTTAGATCGCTTTAAGCTCGAGCTTAAAGCGATCTAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009275
VALIDATED
SRPRB MISSION shRNA Lentiviral Transduction Particles
signal recognition particle receptor, B subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009275.3-1868s1c1
Sequence:CCGGGCTGTCTTCAACATTTGTGTTCTCGAGAACACAAATGTTGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-522s1c1
Sequence:CCGGCCTTATTAATAGCCTGCAATACTCGAGTATTGCAGGCTATTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-292s1c1
Sequence:CCGGCGATAGTTCTGCCATATACAACTCGAGTTGTATATGGCAGAACTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-709s1c1
Sequence:CCGGGTTGCCACTCAAAGTGGAGTTCTCGAGAACTCCACTTTGAGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009275.3-455s1c1
Sequence:CCGGGTGAAAGATGTGGCCGAATTTCTCGAGAAATTCGGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-454s21c1
Sequence:CCGGGTGAAAGATGTGGCCGAATTTCTCGAGAAATTCGGCCACATCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-708s21c1
Sequence:CCGGGTTGCCACTCAAAGTGGAGTTCTCGAGAACTCCACTTTGAGTGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-291s21c1
Sequence:CCGGCGATAGTTCTGCCATATACAACTCGAGTTGTATATGGCAGAACTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-1041s21c1
Sequence:CCGGTCATGTTAGTGTGAGACATAACTCGAGTTATGTCTCACACTAACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009275.4-379s21c1
Sequence:CCGGCAGCTCTTAGATCGCTTTAAGCTCGAGCTTAAAGCGATCTAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks