EMAIL THIS PAGE TO A FRIEND

SRPX2

sushi-repeat containing protein, X-linked 2

Synonyms: BPP CBPS PMGX RESDX SRPUL
UniProtKB ID: O60687, B3KQT3, Q8WW85
Gene ID:
Human(27286) Summary: This gene encodes a secreted protein that contains three sushi repeat motifs. The encoded protein may play a role in the development of speech and language centers in the brain. This protein may also be involved in angiogenesis. Mutations in this gene are the cause of bilateral perisylvian polymicrogyria, rolandic epilepsy, speech dyspraxia and mental retardation. [provided by RefSeq, May 2010]
Mouse(68792) sushi-repeat-containing protein, X-linked 2
Rat(317181) sushi-repeat-containing protein, X-linked 2
naked mole-rat(101721142) sushi-repeat containing protein, X-linked 2
Domestic Rabbit(100343092) sushi-repeat containing protein, X-linked 2
domestic guinea pig(100715891) sushi-repeat containing protein, X-linked 2
cow(514742) sushi-repeat containing protein, X-linked 2
sheep(101109862) sushi-repeat containing protein, X-linked 2
Zebrafish(100332730) sushi-repeat containing protein, X-linked 2
Horse(100057264) sushi-repeat containing protein, X-linked 2
domestic cat(101085607) sushi-repeat containing protein, X-linked 2
chicken(422261) sushi-repeat containing protein, X-linked 2
dog(492014) sushi-repeat containing protein, X-linked 2
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014467 Rosetta Predictions human pricing
NM_001108243 Rosetta Predictions rat pricing
XM_228444 Rosetta Predictions rat pricing
NM_001083895 Rosetta Predictions mouse pricing
NM_026838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235881 predicted 1472
2 SASI_Hs01_00235882 predicted 1785
3 SASI_Hs01_00235883 predicted 1744
4 SASI_Hs01_00235884 predicted 1316
5 SASI_Hs01_00235886 predicted 1430
6 SASI_Hs01_00235887 predicted 1428
7 SASI_Hs01_00235889 predicted 1419
8 SASI_Hs02_00345688 predicted 1856
9 SASI_Hs01_00235890 predicted 1713
10 SASI_Hs02_00345689 predicted 1737
11 SASI_Hs01_00235885 predicted 943
12 SASI_Hs01_00235888 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236734 predicted 1444
2 SASI_Rn02_00236735 predicted 1505
3 SASI_Rn02_00236736 predicted 1101
4 SASI_Rn02_00236737 predicted 966
5 SASI_Rn02_00236738 predicted 1033
6 SASI_Rn02_00236739 predicted 1316
7 SASI_Rn02_00236740 predicted 1215
8 SASI_Rn02_00236741 predicted 778
9 SASI_Rn02_00236742 predicted 801
10 SASI_Rn02_00236743 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170162 predicted 429
2 SASI_Rn01_00170163 predicted 433
3 SASI_Rn01_00170164 predicted 262
4 SASI_Rn01_00170165 predicted 341
5 SASI_Rn01_00170166 predicted 289
6 SASI_Rn01_00170167 predicted 334
7 SASI_Rn01_00170168 predicted 281
8 SASI_Rn01_00170169 predicted 315
9 SASI_Rn01_00170170 predicted 518
10 SASI_Rn01_00170171 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299881 predicted 720
2 SASI_Mm02_00299882 predicted 1731
3 SASI_Mm02_00299883 predicted 1333
4 SASI_Mm02_00299884 predicted 1444
5 SASI_Mm02_00299885 predicted 570
6 SASI_Mm02_00299886 predicted 1011
7 SASI_Mm02_00299887 predicted 1524
8 SASI_Mm02_00299888 predicted 1669
9 SASI_Mm02_00299889 predicted 882
10 SASI_Mm02_00299890 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193021 predicted 765
2 SASI_Mm01_00193022 predicted 1780
3 SASI_Mm01_00193023 predicted 1380
4 SASI_Mm01_00193024 predicted 1495
5 SASI_Mm01_00193025 predicted 622
6 SASI_Mm01_00193026 predicted 1058
7 SASI_Mm02_00331027 predicted 1578
8 SASI_Mm01_00193027 predicted 1721
9 SASI_Mm01_00193028 predicted 935
10 SASI_Mm01_00193029 predicted 1080
11 SASI_Mm01_00193030 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026838
SRPX2 MISSION shRNA Bacterial Glycerol Stock
sushi-repeat containing protein, X-linked 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.1-1710s1c1
Sequence:CCGGGAGCTTAAACTAAGGAGGAAACTCGAGTTTCCTCCTTAGTTTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1819s21c1
Sequence:CCGGTATTGACCGGGAACGCTATATCTCGAGATATAGCGTTCCCGGTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-714s1c1
Sequence:CCGGGATGGTGTTACACATTGAATACTCGAGTATTCAATGTGTAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-1297s1c1
Sequence:CCGGCAGCTGCAAATTCATTGTAAACTCGAGTTTACAATGAATTTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-641s1c1
Sequence:CCGGGAAAGCTACAATGAAGTATATCTCGAGATATACTTCATTGTAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1248s21c1
Sequence:CCGGGAGAACATGTGATTCGTTATACTCGAGTATAACGAATCACATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1499s21c1
Sequence:CCGGTGTACTCCTATGAAGATTAATCTCGAGATTAATCTTCATAGGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026838.2-2303s21c1
Sequence:CCGGTGGTTCCTCTACCCTACAATACTCGAGTATTGTAGGGTAGAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1661s21c1
Sequence:CCGGCTGCGGCATGTGACCATTATTCTCGAGAATAATGGTCACATGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026838
SRPX2 MISSION shRNA shRNA Plasmid DNA
sushi-repeat containing protein, X-linked 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.1-1710s1c1
Sequence:CCGGGAGCTTAAACTAAGGAGGAAACTCGAGTTTCCTCCTTAGTTTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1819s21c1
Sequence:CCGGTATTGACCGGGAACGCTATATCTCGAGATATAGCGTTCCCGGTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-714s1c1
Sequence:CCGGGATGGTGTTACACATTGAATACTCGAGTATTCAATGTGTAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-1297s1c1
Sequence:CCGGCAGCTGCAAATTCATTGTAAACTCGAGTTTACAATGAATTTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-641s1c1
Sequence:CCGGGAAAGCTACAATGAAGTATATCTCGAGATATACTTCATTGTAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1248s21c1
Sequence:CCGGGAGAACATGTGATTCGTTATACTCGAGTATAACGAATCACATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1499s21c1
Sequence:CCGGTGTACTCCTATGAAGATTAATCTCGAGATTAATCTTCATAGGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026838.2-2303s21c1
Sequence:CCGGTGGTTCCTCTACCCTACAATACTCGAGTATTGTAGGGTAGAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1661s21c1
Sequence:CCGGCTGCGGCATGTGACCATTATTCTCGAGAATAATGGTCACATGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026838
SRPX2 MISSION shRNA Lentiviral Transduction Particles
sushi-repeat containing protein, X-linked 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.1-1710s1c1
Sequence:CCGGGAGCTTAAACTAAGGAGGAAACTCGAGTTTCCTCCTTAGTTTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1819s21c1
Sequence:CCGGTATTGACCGGGAACGCTATATCTCGAGATATAGCGTTCCCGGTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-714s1c1
Sequence:CCGGGATGGTGTTACACATTGAATACTCGAGTATTCAATGTGTAACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-1297s1c1
Sequence:CCGGCAGCTGCAAATTCATTGTAAACTCGAGTTTACAATGAATTTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026838.2-641s1c1
Sequence:CCGGGAAAGCTACAATGAAGTATATCTCGAGATATACTTCATTGTAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1248s21c1
Sequence:CCGGGAGAACATGTGATTCGTTATACTCGAGTATAACGAATCACATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1499s21c1
Sequence:CCGGTGTACTCCTATGAAGATTAATCTCGAGATTAATCTTCATAGGAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026838.2-2303s21c1
Sequence:CCGGTGGTTCCTCTACCCTACAATACTCGAGTATTGTAGGGTAGAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026838.2-1661s21c1
Sequence:CCGGCTGCGGCATGTGACCATTATTCTCGAGAATAATGGTCACATGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014467
SRPX2 MISSION shRNA Bacterial Glycerol Stock
sushi-repeat containing protein, X-linked 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-893s1c1
Sequence:CCGGCGCAGCCGAATCTGCATGGAACTCGAGTTCCATGCAGATTCGGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-934s1c1
Sequence:CCGGCGAGCCTGTATGTGTAGACATCTCGAGATGTCTACACATACAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-515s1c1
Sequence:CCGGCCGGATGAAAGCTACAATGAACTCGAGTTCATTGTAGCTTTCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1751s1c1
Sequence:CCGGGATGACTACCTACTGAGCAATCTCGAGATTGCTCAGTAGGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-1040s1c1
Sequence:CCGGCCGTTGGTGAAAGATTCTGCTCTCGAGAGCAGAATCTTTCACCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1037s1c1
Sequence:CCGGCCACCGTTGGTGAAAGATTCTCTCGAGAGAATCTTTCACCAACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014467.1-1953s1c1
Sequence:CCGGCAGTGTTTCCAGGCATCCTTTCTCGAGAAAGGATGCCTGGAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-493s1c1
Sequence:CCGGGTATGCAGGTTCTGGCTACTACTCGAGTAGTAGCCAGAACCTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1469s1c1
Sequence:CCGGGATCCTTCCAACCGATATTATCTCGAGATAATATCGGTTGGAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-1729s1c1
Sequence:CCGGCGAGGAAATCTTCACATTCATCTCGAGATGAATGTGAAGATTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014467
SRPX2 MISSION shRNA shRNA Plasmid DNA
sushi-repeat containing protein, X-linked 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-893s1c1
Sequence:CCGGCGCAGCCGAATCTGCATGGAACTCGAGTTCCATGCAGATTCGGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-934s1c1
Sequence:CCGGCGAGCCTGTATGTGTAGACATCTCGAGATGTCTACACATACAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-515s1c1
Sequence:CCGGCCGGATGAAAGCTACAATGAACTCGAGTTCATTGTAGCTTTCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1751s1c1
Sequence:CCGGGATGACTACCTACTGAGCAATCTCGAGATTGCTCAGTAGGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-1040s1c1
Sequence:CCGGCCGTTGGTGAAAGATTCTGCTCTCGAGAGCAGAATCTTTCACCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1037s1c1
Sequence:CCGGCCACCGTTGGTGAAAGATTCTCTCGAGAGAATCTTTCACCAACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014467.1-1953s1c1
Sequence:CCGGCAGTGTTTCCAGGCATCCTTTCTCGAGAAAGGATGCCTGGAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-493s1c1
Sequence:CCGGGTATGCAGGTTCTGGCTACTACTCGAGTAGTAGCCAGAACCTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1469s1c1
Sequence:CCGGGATCCTTCCAACCGATATTATCTCGAGATAATATCGGTTGGAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-1729s1c1
Sequence:CCGGCGAGGAAATCTTCACATTCATCTCGAGATGAATGTGAAGATTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014467
SRPX2 MISSION shRNA Lentiviral Transduction Particles
sushi-repeat containing protein, X-linked 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-893s1c1
Sequence:CCGGCGCAGCCGAATCTGCATGGAACTCGAGTTCCATGCAGATTCGGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-934s1c1
Sequence:CCGGCGAGCCTGTATGTGTAGACATCTCGAGATGTCTACACATACAGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-515s1c1
Sequence:CCGGCCGGATGAAAGCTACAATGAACTCGAGTTCATTGTAGCTTTCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1751s1c1
Sequence:CCGGGATGACTACCTACTGAGCAATCTCGAGATTGCTCAGTAGGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-1040s1c1
Sequence:CCGGCCGTTGGTGAAAGATTCTGCTCTCGAGAGCAGAATCTTTCACCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1037s1c1
Sequence:CCGGCCACCGTTGGTGAAAGATTCTCTCGAGAGAATCTTTCACCAACGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014467.1-1953s1c1
Sequence:CCGGCAGTGTTTCCAGGCATCCTTTCTCGAGAAAGGATGCCTGGAAACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-493s1c1
Sequence:CCGGGTATGCAGGTTCTGGCTACTACTCGAGTAGTAGCCAGAACCTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014467.1-1469s1c1
Sequence:CCGGGATCCTTCCAACCGATATTATCTCGAGATAATATCGGTTGGAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014467.1-1729s1c1
Sequence:CCGGCGAGGAAATCTTCACATTCATCTCGAGATGAATGTGAAGATTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks