EMAIL THIS PAGE TO A FRIEND

SRPX

sushi-repeat containing protein, X-linked

Synonyms: DRS ETX1 SRPX1
Gene ID:
Mouse(51795) sushi-repeat-containing protein
Rat(64316) sushi-repeat-containing protein, X-linked
Zebrafish(541513) sushi-repeat-containing protein
Horse(100055486) sushi-repeat containing protein, X-linked
chicken(418579) sushi-repeat containing protein, X-linked
domestic cat(101083491) sushi-repeat containing protein, X-linked
dog(491828) sushi-repeat containing protein, X-linked
cow(337918) sushi-repeat containing protein, X-linked
sheep(101121073) sushi-repeat containing protein, X-linked
domestic guinea pig(100719968) sushi-repeat containing protein, X-linked
naked mole-rat(101707216) sushi-repeat containing protein, X-linked
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006307 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070411 MISSION® esiRNA esiRNA human SRPX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006307 Rosetta Predictions human pricing
NM_022524 Rosetta Predictions rat pricing
NM_016911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019412 predicted 854
2 SASI_Hs01_00019413 predicted 1314
3 SASI_Hs01_00019414 predicted 1389
4 SASI_Hs02_00341326 predicted 801
5 SASI_Hs01_00019415 predicted 721
6 SASI_Hs01_00019416 predicted 829
7 SASI_Hs01_00019417 predicted 618
8 SASI_Hs01_00019418 predicted 728
9 SASI_Hs01_00019419 predicted 721
10 SASI_Hs01_00019420 predicted 795
11 SASI_Hs01_00019421 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050904 predicted 800
2 SASI_Rn01_00050905 predicted 774
3 SASI_Rn01_00050906 predicted 606
4 SASI_Rn01_00050907 predicted 1313
5 SASI_Rn01_00050908 predicted 682
6 SASI_Rn01_00050909 predicted 822
7 SASI_Rn01_00050910 predicted 438
8 SASI_Rn01_00050911 predicted 1337
9 SASI_Rn01_00050912 predicted 810
10 SASI_Rn02_00263273 predicted 1331
11 SASI_Rn01_00050903 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024294 predicted 247
2 SASI_Mm01_00024295 predicted 760
3 SASI_Mm01_00024296 predicted 868
4 SASI_Mm01_00024297 predicted 244
5 SASI_Mm01_00024298 predicted 660
6 SASI_Mm01_00024299 predicted 838
7 SASI_Mm01_00024300 predicted 1370
8 SASI_Mm01_00024301 predicted 368
9 SASI_Mm01_00024302 predicted 873
10 SASI_Mm01_00024303 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006307
SRPX MISSION shRNA Bacterial Glycerol Stock
sushi-repeat containing protein, X-linked
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-833s1c1
Sequence:CCGGGCACTTGCAAATTTCGAGTTACTCGAGTAACTCGAAATTTGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-888s1c1
Sequence:CCGGCCCAGAGAATGGTTACATGAACTCGAGTTCATGTAACCATTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-1314s1c1
Sequence:CCGGCCCACTCTACTCCTTCAGTATCTCGAGATACTGAAGGAGTAGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-384s1c1
Sequence:CCGGCCTACTGATCTGCCAGTCAAACTCGAGTTTGACTGGCAGATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006307.2-1744s1c1
Sequence:CCGGCCATAACCATACACAGGCTATCTCGAGATAGCCTGTGTATGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006307
SRPX MISSION shRNA shRNA Plasmid DNA
sushi-repeat containing protein, X-linked
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-833s1c1
Sequence:CCGGGCACTTGCAAATTTCGAGTTACTCGAGTAACTCGAAATTTGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-888s1c1
Sequence:CCGGCCCAGAGAATGGTTACATGAACTCGAGTTCATGTAACCATTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-1314s1c1
Sequence:CCGGCCCACTCTACTCCTTCAGTATCTCGAGATACTGAAGGAGTAGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-384s1c1
Sequence:CCGGCCTACTGATCTGCCAGTCAAACTCGAGTTTGACTGGCAGATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006307.2-1744s1c1
Sequence:CCGGCCATAACCATACACAGGCTATCTCGAGATAGCCTGTGTATGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006307
SRPX MISSION shRNA Lentiviral Transduction Particles
sushi-repeat containing protein, X-linked
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-833s1c1
Sequence:CCGGGCACTTGCAAATTTCGAGTTACTCGAGTAACTCGAAATTTGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-888s1c1
Sequence:CCGGCCCAGAGAATGGTTACATGAACTCGAGTTCATGTAACCATTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-1314s1c1
Sequence:CCGGCCCACTCTACTCCTTCAGTATCTCGAGATACTGAAGGAGTAGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006307.2-384s1c1
Sequence:CCGGCCTACTGATCTGCCAGTCAAACTCGAGTTTGACTGGCAGATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006307.2-1744s1c1
Sequence:CCGGCCATAACCATACACAGGCTATCTCGAGATAGCCTGTGTATGGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016911
SRPX MISSION shRNA Bacterial Glycerol Stock
sushi-repeat containing protein, X-linked
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-1286s1c1
Sequence:CCGGGCAGGATCAGAGCAAAGATTACTCGAGTAATCTTTGCTCTGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-675s1c1
Sequence:CCGGCCCAAGTGTGAAAGAACGTATCTCGAGATACGTTCTTTCACACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-1075s1c1
Sequence:CCGGGCAGCGATGAATGTCAATGTTCTCGAGAACATTGACATTCATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016911.2-1540s1c1
Sequence:CCGGGCTCCTCATCTCTTATTCTATCTCGAGATAGAATAAGAGATGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016911
SRPX MISSION shRNA shRNA Plasmid DNA
sushi-repeat containing protein, X-linked
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-1286s1c1
Sequence:CCGGGCAGGATCAGAGCAAAGATTACTCGAGTAATCTTTGCTCTGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-675s1c1
Sequence:CCGGCCCAAGTGTGAAAGAACGTATCTCGAGATACGTTCTTTCACACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-1075s1c1
Sequence:CCGGGCAGCGATGAATGTCAATGTTCTCGAGAACATTGACATTCATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016911.2-1540s1c1
Sequence:CCGGGCTCCTCATCTCTTATTCTATCTCGAGATAGAATAAGAGATGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016911
SRPX MISSION shRNA Lentiviral Transduction Particles
sushi-repeat containing protein, X-linked
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-1286s1c1
Sequence:CCGGGCAGGATCAGAGCAAAGATTACTCGAGTAATCTTTGCTCTGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-675s1c1
Sequence:CCGGCCCAAGTGTGAAAGAACGTATCTCGAGATACGTTCTTTCACACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016911.2-1075s1c1
Sequence:CCGGGCAGCGATGAATGTCAATGTTCTCGAGAACATTGACATTCATCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016911.2-1540s1c1
Sequence:CCGGGCTCCTCATCTCTTATTCTATCTCGAGATAGAATAAGAGATGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks