EMAIL THIS PAGE TO A FRIEND

SRR

serine racemase

Synonyms: ILV1 ISO1
UniProtKB ID: Q9GZT4, D3DTI5, Q6IA55
Gene ID:
Mouse(27364) serine racemase
Rat(303306) serine racemase
chicken(771635) serine racemase
dog(491200) serine racemase
domestic cat(101098904) serine racemase
cow(525340) serine racemase
sheep(101118200) serine racemase
naked mole-rat(101701179) serine racemase
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021947 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021947 Rosetta Predictions human pricing
NM_198757 Rosetta Predictions rat pricing
NM_013761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170553 predicted 352
2 SASI_Hs02_00355269 predicted 560
3 SASI_Hs01_00170554 predicted 660
4 SASI_Hs02_00355270 predicted 662
5 SASI_Hs01_00170555 predicted 502
6 SASI_Hs01_00170557 predicted 648
7 SASI_Hs01_00170558 predicted 897
8 SASI_Hs01_00170559 predicted 540
9 SASI_Hs01_00170560 predicted 735
10 SASI_Hs01_00170561 predicted 278
11 SASI_Hs01_00170556 predicted 777
12 SASI_Hs01_00170562 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060380 predicted 408
2 SASI_Rn02_00269988 predicted 713
3 SASI_Rn02_00269989 predicted 1371
4 SASI_Rn01_00060382 predicted 1346
5 SASI_Rn01_00060383 predicted 368
6 SASI_Rn01_00060384 predicted 1402
7 SASI_Rn01_00060385 predicted 1200
8 SASI_Rn01_00060386 predicted 333
9 SASI_Rn01_00060387 predicted 903
10 SASI_Rn01_00060388 predicted 819
11 SASI_Rn01_00060381 predicted 743
12 SASI_Rn01_00060389 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100384 predicted 802
2 SASI_Mm02_00322708 predicted 396
3 SASI_Mm01_00100385 predicted 351
4 SASI_Mm01_00100386 predicted 723
5 SASI_Mm01_00100387 predicted 673
6 SASI_Mm01_00100388 predicted 354
7 SASI_Mm01_00100389 predicted 702
8 SASI_Mm01_00100390 predicted 560
9 SASI_Mm01_00100392 predicted 684
10 SASI_Mm01_00100393 predicted 889
11 SASI_Mm01_00100391 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013761
VALIDATED
SRR MISSION shRNA Bacterial Glycerol Stock
serine racemase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-595s21c1
Sequence:CCGGGCTGCTAAACTGGAAGGAATTCTCGAGAATTCCTTCCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-885s21c1
Sequence:CCGGTGCTGGAATAGCCATTACAATCTCGAGATTGTAATGGCTATTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-394s21c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013761.3-2176s21c1
Sequence:CCGGCCGTAGCTCTAGTCTACTTTACTCGAGTAAAGTAGACTAGAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-2177s1c1
Sequence:CCGGCCGTAGCTCTAGTCTACTTTACTCGAGTAAAGTAGACTAGAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-898s1c1
Sequence:CCGGCATTACAATTAAGGCCCTGAACTCGAGTTCAGGGCCTTAATTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-886s1c1
Sequence:CCGGTGCTGGAATAGCCATTACAATCTCGAGATTGTAATGGCTATTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-395s1c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-596s1c1
Sequence:CCGGGCTGCTAAACTGGAAGGAATTCTCGAGAATTCCTTCCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013761
VALIDATED
SRR MISSION shRNA shRNA Plasmid DNA
serine racemase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-595s21c1
Sequence:CCGGGCTGCTAAACTGGAAGGAATTCTCGAGAATTCCTTCCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-885s21c1
Sequence:CCGGTGCTGGAATAGCCATTACAATCTCGAGATTGTAATGGCTATTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-394s21c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013761.3-2176s21c1
Sequence:CCGGCCGTAGCTCTAGTCTACTTTACTCGAGTAAAGTAGACTAGAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-2177s1c1
Sequence:CCGGCCGTAGCTCTAGTCTACTTTACTCGAGTAAAGTAGACTAGAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-898s1c1
Sequence:CCGGCATTACAATTAAGGCCCTGAACTCGAGTTCAGGGCCTTAATTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-886s1c1
Sequence:CCGGTGCTGGAATAGCCATTACAATCTCGAGATTGTAATGGCTATTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-395s1c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-596s1c1
Sequence:CCGGGCTGCTAAACTGGAAGGAATTCTCGAGAATTCCTTCCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013761
VALIDATED
SRR MISSION shRNA Lentiviral Transduction Particles
serine racemase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-595s21c1
Sequence:CCGGGCTGCTAAACTGGAAGGAATTCTCGAGAATTCCTTCCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-885s21c1
Sequence:CCGGTGCTGGAATAGCCATTACAATCTCGAGATTGTAATGGCTATTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013761.3-394s21c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013761.3-2176s21c1
Sequence:CCGGCCGTAGCTCTAGTCTACTTTACTCGAGTAAAGTAGACTAGAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-2177s1c1
Sequence:CCGGCCGTAGCTCTAGTCTACTTTACTCGAGTAAAGTAGACTAGAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-898s1c1
Sequence:CCGGCATTACAATTAAGGCCCTGAACTCGAGTTCAGGGCCTTAATTGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-886s1c1
Sequence:CCGGTGCTGGAATAGCCATTACAATCTCGAGATTGTAATGGCTATTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-395s1c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_013761.2-596s1c1
Sequence:CCGGGCTGCTAAACTGGAAGGAATTCTCGAGAATTCCTTCCAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021947
VALIDATED
SRR MISSION shRNA Bacterial Glycerol Stock
serine racemase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021947.1-631s21c1
Sequence:CCGGGAATGCTTGCTGGAATAGCAACTCGAGTTGCTATTCCAGCAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021947.1-751s21c1
Sequence:CCGGCCAATCTTTATCCTCCAGAAACTCGAGTTTCTGGAGGATAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-111s21c1
Sequence:CCGGGCTCATATCAACATTCGAGATCTCGAGATCTCGAATGTTGATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-456s21c1
Sequence:CCGGCCTAGTGATGAGTCCAGAGAACTCGAGTTCTCTGGACTCATCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-279s21c1
Sequence:CCGGGCTTTAGAAAGGAAGCCGAAACTCGAGTTTCGGCTTCCTTTCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021947.1-2193s1c1
Sequence:CCGGGCCCACACTTAACCTTGTCAACTCGAGTTGACAAGGTTAAGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-456s1c1
Sequence:CCGGCCTAGTGATGAGTCCAGAGAACTCGAGTTCTCTGGACTCATCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-631s1c1
Sequence:CCGGGAATGCTTGCTGGAATAGCAACTCGAGTTGCTATTCCAGCAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-111s1c1
Sequence:CCGGGCTCATATCAACATTCGAGATCTCGAGATCTCGAATGTTGATATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021947.1-1794s1c1
Sequence:CCGGCCTCTTAGAATCAAACACATTCTCGAGAATGTGTTTGATTCTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-751s1c1
Sequence:CCGGCCAATCTTTATCCTCCAGAAACTCGAGTTTCTGGAGGATAAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-279s1c1
Sequence:CCGGGCTTTAGAAAGGAAGCCGAAACTCGAGTTTCGGCTTCCTTTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021947.1-1062s1c1
Sequence:CCGGCCAGCTTCTTATCAGTCTGTTCTCGAGAACAGACTGATAAGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-147s1c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-170s1c1
Sequence:CCGGGAATCAACTAACAGGGCGCAACTCGAGTTGCGCCCTGTTAGTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021947.1-1061s1c1
Sequence:CCGGGCCAGCTTCTTATCAGTCTGTCTCGAGACAGACTGATAAGAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021947
VALIDATED
SRR MISSION shRNA shRNA Plasmid DNA
serine racemase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021947.1-631s21c1
Sequence:CCGGGAATGCTTGCTGGAATAGCAACTCGAGTTGCTATTCCAGCAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021947.1-751s21c1
Sequence:CCGGCCAATCTTTATCCTCCAGAAACTCGAGTTTCTGGAGGATAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-111s21c1
Sequence:CCGGGCTCATATCAACATTCGAGATCTCGAGATCTCGAATGTTGATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-456s21c1
Sequence:CCGGCCTAGTGATGAGTCCAGAGAACTCGAGTTCTCTGGACTCATCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-279s21c1
Sequence:CCGGGCTTTAGAAAGGAAGCCGAAACTCGAGTTTCGGCTTCCTTTCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021947.1-2193s1c1
Sequence:CCGGGCCCACACTTAACCTTGTCAACTCGAGTTGACAAGGTTAAGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-456s1c1
Sequence:CCGGCCTAGTGATGAGTCCAGAGAACTCGAGTTCTCTGGACTCATCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-631s1c1
Sequence:CCGGGAATGCTTGCTGGAATAGCAACTCGAGTTGCTATTCCAGCAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-111s1c1
Sequence:CCGGGCTCATATCAACATTCGAGATCTCGAGATCTCGAATGTTGATATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021947.1-1794s1c1
Sequence:CCGGCCTCTTAGAATCAAACACATTCTCGAGAATGTGTTTGATTCTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-751s1c1
Sequence:CCGGCCAATCTTTATCCTCCAGAAACTCGAGTTTCTGGAGGATAAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-279s1c1
Sequence:CCGGGCTTTAGAAAGGAAGCCGAAACTCGAGTTTCGGCTTCCTTTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021947.1-1062s1c1
Sequence:CCGGCCAGCTTCTTATCAGTCTGTTCTCGAGAACAGACTGATAAGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-147s1c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-170s1c1
Sequence:CCGGGAATCAACTAACAGGGCGCAACTCGAGTTGCGCCCTGTTAGTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021947.1-1061s1c1
Sequence:CCGGGCCAGCTTCTTATCAGTCTGTCTCGAGACAGACTGATAAGAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021947
VALIDATED
SRR MISSION shRNA Lentiviral Transduction Particles
serine racemase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021947.1-631s21c1
Sequence:CCGGGAATGCTTGCTGGAATAGCAACTCGAGTTGCTATTCCAGCAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_021947.1-751s21c1
Sequence:CCGGCCAATCTTTATCCTCCAGAAACTCGAGTTTCTGGAGGATAAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-111s21c1
Sequence:CCGGGCTCATATCAACATTCGAGATCTCGAGATCTCGAATGTTGATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-456s21c1
Sequence:CCGGCCTAGTGATGAGTCCAGAGAACTCGAGTTCTCTGGACTCATCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021947.1-279s21c1
Sequence:CCGGGCTTTAGAAAGGAAGCCGAAACTCGAGTTTCGGCTTCCTTTCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021947.1-2193s1c1
Sequence:CCGGGCCCACACTTAACCTTGTCAACTCGAGTTGACAAGGTTAAGTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-456s1c1
Sequence:CCGGCCTAGTGATGAGTCCAGAGAACTCGAGTTCTCTGGACTCATCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-631s1c1
Sequence:CCGGGAATGCTTGCTGGAATAGCAACTCGAGTTGCTATTCCAGCAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-111s1c1
Sequence:CCGGGCTCATATCAACATTCGAGATCTCGAGATCTCGAATGTTGATATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021947.1-1794s1c1
Sequence:CCGGCCTCTTAGAATCAAACACATTCTCGAGAATGTGTTTGATTCTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-751s1c1
Sequence:CCGGCCAATCTTTATCCTCCAGAAACTCGAGTTTCTGGAGGATAAAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-279s1c1
Sequence:CCGGGCTTTAGAAAGGAAGCCGAAACTCGAGTTTCGGCTTCCTTTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021947.1-1062s1c1
Sequence:CCGGCCAGCTTCTTATCAGTCTGTTCTCGAGAACAGACTGATAAGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-147s1c1
Sequence:CCGGCCAGTGCTAACAAGCTCCATTCTCGAGAATGGAGCTTGTTAGCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021947.1-170s1c1
Sequence:CCGGGAATCAACTAACAGGGCGCAACTCGAGTTGCGCCCTGTTAGTTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021947.1-1061s1c1
Sequence:CCGGGCCAGCTTCTTATCAGTCTGTCTCGAGACAGACTGATAAGAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks