EMAIL THIS PAGE TO A FRIEND

SRRD

SRR1 domain containing

Synonyms: HC/HCC SRR1L
UniProtKB ID: Q9UH36, Q6NXP8
Gene ID:
Mouse(70118) SRR1 domain containing
Rat(288717) SRR1 domain containing
Zebrafish(751717) SRR1 domain containing
chicken(416908) SRR1 domain containing
dog(486331) SRR1 domain containing
domestic cat(101090901) SRR1 domain containing
naked mole-rat(101716568) SRR1 domain containing
domestic guinea pig(100728844) SRR1 domain containing
cow(615429) SRR1 domain containing
sheep(101118644) SRR1 domain containing
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013694 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027323 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027323 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027323 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013694 Rosetta Predictions human pricing
XM_001080556 Rosetta Predictions rat pricing
XM_213799 Rosetta Predictions rat pricing
NM_027323 Rosetta Predictions mouse pricing
XM_485670 Rosetta Predictions mouse pricing
XM_894571 Rosetta Predictions mouse pricing
XM_901663 Rosetta Predictions mouse pricing
XM_901668 Rosetta Predictions mouse pricing
XM_901673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234265 predicted 703
2 SASI_Hs02_00306467 predicted 724
3 SASI_Hs01_00234266 predicted 906
4 SASI_Hs01_00234267 predicted 991
5 SASI_Hs01_00234269 predicted 868
6 SASI_Hs01_00234270 predicted 461
7 SASI_Hs01_00234271 predicted 949
8 SASI_Hs01_00234272 predicted 1020
9 SASI_Hs01_00234273 predicted 716
10 SASI_Hs01_00234274 predicted 531
11 SASI_Hs01_00234268 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368412 predicted 230
2 SASI_Rn02_00368413 predicted 366
3 SASI_Rn02_00368414 predicted 416
4 SASI_Rn02_00368415 predicted 209
5 SASI_Rn02_00368416 predicted 634
6 SASI_Rn02_00368417 predicted 781
7 SASI_Rn02_00368418 predicted 691
8 SASI_Rn02_00368419 predicted 831
9 SASI_Rn02_00368420 predicted 806
10 SASI_Rn02_00368421 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374926 predicted 342
2 SASI_Rn02_00374927 predicted 371
3 SASI_Rn02_00374928 predicted 418
4 SASI_Rn02_00374929 predicted 486
5 SASI_Rn02_00374930 predicted 288
6 SASI_Rn02_00374931 predicted 352
7 SASI_Rn02_00374932 predicted 486
8 SASI_Rn02_00374933 predicted 488
9 SASI_Rn02_00374934 predicted 492
10 SASI_Rn02_00374935 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331946 predicted 446
2 SASI_Mm02_00331947 predicted 196
3 SASI_Mm02_00331948 predicted 570
4 SASI_Mm02_00331949 predicted 801
5 SASI_Mm02_00331950 predicted 835
6 SASI_Mm02_00331951 predicted 721
7 SASI_Mm02_00331952 predicted 262
8 SASI_Mm02_00331953 predicted 385
9 SASI_Mm02_00331954 predicted 742
10 SASI_Mm02_00331955 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237502 predicted 209
2 SASI_Mm01_00237503 predicted 720
3 SASI_Mm01_00237504 predicted 1126
4 SASI_Mm01_00237505 predicted 1051
5 SASI_Mm01_00237506 predicted 998
6 SASI_Mm01_00237507 predicted 265
7 SASI_Mm01_00237508 predicted 389
8 SASI_Mm01_00237509 predicted 772
9 SASI_Mm01_00237510 predicted 868
10 SASI_Mm01_00237511 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240154 predicted 461
2 SASI_Mm01_00240155 predicted 201
3 SASI_Mm01_00240156 predicted 578
4 SASI_Mm01_00240157 predicted 840
5 SASI_Mm01_00240158 predicted 733
6 SASI_Mm01_00240159 predicted 272
7 SASI_Mm01_00240160 predicted 395
8 SASI_Mm01_00240161 predicted 807
9 SASI_Mm01_00240162 predicted 742
10 SASI_Mm01_00240163 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218609 predicted 608
2 SASI_Mm01_00218610 predicted 1017
3 SASI_Mm01_00218611 predicted 942
4 SASI_Mm01_00218612 predicted 889
5 SASI_Mm01_00218613 predicted 662
6 SASI_Mm01_00218614 predicted 549
7 SASI_Mm01_00218615 predicted 761
8 SASI_Mm01_00218616 predicted 683
9 SASI_Mm01_00218617 predicted 538
10 SASI_Mm01_00218618 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280574 predicted 773
2 SASI_Mm01_00280575 predicted 568
3 SASI_Mm01_00280576 predicted 798
4 SASI_Mm01_00280577 predicted 567
5 SASI_Mm01_00280578 predicted 761
6 SASI_Mm01_00280579 predicted 648
7 SASI_Mm01_00280580 predicted 851
8 SASI_Mm01_00280581 predicted 793
9 SASI_Mm01_00280582 predicted 643
10 SASI_Mm01_00280583 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256294 predicted 459
2 SASI_Mm01_00256295 predicted 206
3 SASI_Mm01_00256296 predicted 579
4 SASI_Mm01_00256297 predicted 809
5 SASI_Mm01_00256298 predicted 267
6 SASI_Mm01_00256299 predicted 386
7 SASI_Mm01_00256300 predicted 779
8 SASI_Mm01_00256301 predicted 668
9 SASI_Mm01_00256302 predicted 526
10 SASI_Mm01_00256303 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013694
SRRD MISSION shRNA Bacterial Glycerol Stock
SRR1 domain containing
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1093s1c1
Sequence:CCGGGAGAACTCCTTTGCCAGGAAACTCGAGTTTCCTGGCAAAGGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013694.1-1105s1c1
Sequence:CCGGGCCAGGAAAGAACATCAACTTCTCGAGAAGTTGATGTTCTTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-453s1c1
Sequence:CCGGGCTAGAAACCAGCTAACGTTTCTCGAGAAACGTTAGCTGGTTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-506s1c1
Sequence:CCGGCAGAAGTCACTGTTGGGTATACTCGAGTATACCCAACAGTGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1077s1c1
Sequence:CCGGCTATGGAGGAACTACAGAGAACTCGAGTTCTCTGTAGTTCCTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-530s1c1
Sequence:CCGGCCCTCTGTTTAGCCAACTTGACTCGAGTCAAGTTGGCTAAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1117s1c1
Sequence:CCGGCATCAACTTGGCTGTCCTGTTCTCGAGAACAGGACAGCCAAGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013694.1-900s1c1
Sequence:CCGGGAACAGCTCTCCATAGATATTCTCGAGAATATCTATGGAGAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-234s1c1
Sequence:CCGGGCACTAGAAACCATCAATAGACTCGAGTCTATTGATGGTTTCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013694
SRRD MISSION shRNA shRNA Plasmid DNA
SRR1 domain containing
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1093s1c1
Sequence:CCGGGAGAACTCCTTTGCCAGGAAACTCGAGTTTCCTGGCAAAGGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013694.1-1105s1c1
Sequence:CCGGGCCAGGAAAGAACATCAACTTCTCGAGAAGTTGATGTTCTTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-453s1c1
Sequence:CCGGGCTAGAAACCAGCTAACGTTTCTCGAGAAACGTTAGCTGGTTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-506s1c1
Sequence:CCGGCAGAAGTCACTGTTGGGTATACTCGAGTATACCCAACAGTGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1077s1c1
Sequence:CCGGCTATGGAGGAACTACAGAGAACTCGAGTTCTCTGTAGTTCCTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-530s1c1
Sequence:CCGGCCCTCTGTTTAGCCAACTTGACTCGAGTCAAGTTGGCTAAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1117s1c1
Sequence:CCGGCATCAACTTGGCTGTCCTGTTCTCGAGAACAGGACAGCCAAGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013694.1-900s1c1
Sequence:CCGGGAACAGCTCTCCATAGATATTCTCGAGAATATCTATGGAGAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-234s1c1
Sequence:CCGGGCACTAGAAACCATCAATAGACTCGAGTCTATTGATGGTTTCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013694
SRRD MISSION shRNA Lentiviral Transduction Particles
SRR1 domain containing
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122654    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1093s1c1
Sequence:CCGGGAGAACTCCTTTGCCAGGAAACTCGAGTTTCCTGGCAAAGGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013694.1-1105s1c1
Sequence:CCGGGCCAGGAAAGAACATCAACTTCTCGAGAAGTTGATGTTCTTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-453s1c1
Sequence:CCGGGCTAGAAACCAGCTAACGTTTCTCGAGAAACGTTAGCTGGTTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-506s1c1
Sequence:CCGGCAGAAGTCACTGTTGGGTATACTCGAGTATACCCAACAGTGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1077s1c1
Sequence:CCGGCTATGGAGGAACTACAGAGAACTCGAGTTCTCTGTAGTTCCTCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-530s1c1
Sequence:CCGGCCCTCTGTTTAGCCAACTTGACTCGAGTCAAGTTGGCTAAACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013694.1-1117s1c1
Sequence:CCGGCATCAACTTGGCTGTCCTGTTCTCGAGAACAGGACAGCCAAGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013694.1-900s1c1
Sequence:CCGGGAACAGCTCTCCATAGATATTCTCGAGAATATCTATGGAGAGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013694.1-234s1c1
Sequence:CCGGGCACTAGAAACCATCAATAGACTCGAGTCTATTGATGGTTTCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027323
VALIDATED
SRRD MISSION shRNA Bacterial Glycerol Stock
SRR1 domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-207s21c1
Sequence:CCGGGAAACCATCACCGAGTGTCTTCTCGAGAAGACACTCGGTGATGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-170s21c1
Sequence:CCGGGGACCTGCGGATCTCTGATTTCTCGAGAAATCAGAGATCCGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027323.2-684s21c1
Sequence:CCGGGAAAGGTTGTTGGCGAGGATTCTCGAGAATCCTCGCCAACAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-581s21c1
Sequence:CCGGACACTGTGGGACAGCTCTATACTCGAGTATAGAGCTGTCCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-442s21c1
Sequence:CCGGGAAGTCACTGCTGGGTCTATGCTCGAGCATAGACCCAGCAGTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027323
VALIDATED
SRRD MISSION shRNA shRNA Plasmid DNA
SRR1 domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-207s21c1
Sequence:CCGGGAAACCATCACCGAGTGTCTTCTCGAGAAGACACTCGGTGATGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-170s21c1
Sequence:CCGGGGACCTGCGGATCTCTGATTTCTCGAGAAATCAGAGATCCGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027323.2-684s21c1
Sequence:CCGGGAAAGGTTGTTGGCGAGGATTCTCGAGAATCCTCGCCAACAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-581s21c1
Sequence:CCGGACACTGTGGGACAGCTCTATACTCGAGTATAGAGCTGTCCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-442s21c1
Sequence:CCGGGAAGTCACTGCTGGGTCTATGCTCGAGCATAGACCCAGCAGTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027323
VALIDATED
SRRD MISSION shRNA Lentiviral Transduction Particles
SRR1 domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-207s21c1
Sequence:CCGGGAAACCATCACCGAGTGTCTTCTCGAGAAGACACTCGGTGATGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-170s21c1
Sequence:CCGGGGACCTGCGGATCTCTGATTTCTCGAGAAATCAGAGATCCGCAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027323.2-684s21c1
Sequence:CCGGGAAAGGTTGTTGGCGAGGATTCTCGAGAATCCTCGCCAACAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-581s21c1
Sequence:CCGGACACTGTGGGACAGCTCTATACTCGAGTATAGAGCTGTCCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027323.2-442s21c1
Sequence:CCGGGAAGTCACTGCTGGGTCTATGCTCGAGCATAGACCCAGCAGTGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks