EMAIL THIS PAGE TO A FRIEND

SRRM1

serine/arginine repetitive matrix 1

Synonyms: 160-KD POP101 SRM160
UniProtKB ID: Q8IYB3, O60585, Q5VVN4
Gene ID:
Mouse(51796) serine/arginine repetitive matrix 1
Rat(313620) serine/arginine repetitive matrix 1
cow(784123) serine/arginine repetitive matrix 1
domestic guinea pig(100736123) serine/arginine repetitive matrix 1
naked mole-rat(101724550) serine/arginine repetitive matrix 1
Zebrafish(406751) serine/arginine repetitive matrix 1
dog(478185) serine/arginine repetitive matrix 1
chicken(428216) serine/arginine repetitive matrix 1
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005839 Rosetta Predictions human pricing
NM_001107986 Rosetta Predictions rat pricing
NM_001130477 Rosetta Predictions mouse pricing
NM_016799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194283 predicted 394
2 SASI_Hs01_00194284 predicted 387
3 SASI_Hs01_00194285 predicted 416
4 SASI_Hs01_00194286 predicted 1240
5 SASI_Hs01_00194289 predicted 416
6 SASI_Hs02_00340374 predicted 2009
7 SASI_Hs01_00194291 predicted 408
8 SASI_Hs02_00340375 predicted 2017
9 SASI_Hs02_00340376 predicted 2167
10 SASI_Hs01_00194292 predicted 359
11 SASI_Hs01_00194287 predicted 349
12 SASI_Hs01_00194288 predicted 303
13 SASI_Hs01_00194290 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234235 predicted 2751
2 SASI_Rn02_00234236 predicted 1942
3 SASI_Rn02_00234237 predicted 272
4 SASI_Rn02_00234238 predicted 215
5 SASI_Rn02_00234239 predicted 1991
6 SASI_Rn02_00234240 predicted 2739
7 SASI_Rn02_00234241 predicted 216
8 SASI_Rn02_00234242 predicted 1082
9 SASI_Rn02_00234243 predicted 534
10 SASI_Rn02_00234244 predicted 3186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311318 predicted 260
2 SASI_Mm02_00311319 predicted 217
3 SASI_Mm02_00311320 predicted 294
4 SASI_Mm02_00311321 predicted 279
5 SASI_Mm02_00311322 predicted 394
6 SASI_Mm02_00311323 predicted 227
7 SASI_Mm02_00311324 predicted 610
8 SASI_Mm02_00311325 predicted 1236
9 SASI_Mm02_00311326 predicted 344
10 SASI_Mm02_00311327 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323582 predicted 265
2 SASI_Mm02_00323583 predicted 213
3 SASI_Mm01_00124659 predicted 295
4 SASI_Mm01_00124660 predicted 280
5 SASI_Mm01_00124665 predicted 389
6 SASI_Mm02_00323584 predicted 227
7 SASI_Mm02_00323585 predicted 608
8 SASI_Mm02_00323586 predicted 1250
9 SASI_Mm02_00323587 predicted 347
10 SASI_Mm02_00323588 predicted 204
11 SASI_Mm01_00124657 predicted 304
12 SASI_Mm01_00124658 predicted 1619
13 SASI_Mm01_00124661 predicted 384
14 SASI_Mm01_00124662 predicted 219
15 SASI_Mm01_00124663 predicted 1662
16 SASI_Mm01_00124664 predicted 1233
17 SASI_Mm01_00124666 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005839
SRRM1 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-2607s21c1
Sequence:CCGGAGCCCATCACCGCCAAGAAATCTCGAGATTTCTTGGCGGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-1519s21c1
Sequence:CCGGCAGGGAGAACTTCAGGTAAAGCTCGAGCTTTACCTGAAGTTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-1605s21c1
Sequence:CCGGGAGTTATCTGAATCGGAAGAACTCGAGTTCTTCCGATTCAGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005839.3-3011s21c1
Sequence:CCGGGTTTGAGCTTTAGACTATAACCTCGAGGTTATAGTCTAAAGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-2250s21c1
Sequence:CCGGCCACAACCAAACAAACGGCATCTCGAGATGCCGTTTGTTTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1444s1c1
Sequence:CCGGGACGCCAATACAGACGACAAACTCGAGTTTGTCGTCTGTATTGGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1253s1c1
Sequence:CCGGGCAGTCAAACCGTACAAGAAACTCGAGTTTCTTGTACGGTTTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005839.x-3369s1c1
Sequence:CCGGTCATTCTGTTATTCTGGCTTCCTCGAGGAAGCCAGAATAACAGAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-2025s1c1
Sequence:CCGGCCACAACCAAACAAACGGCATCTCGAGATGCCGTTTGTTTGGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1443s1c1
Sequence:CCGGAGACGCCAATACAGACGACAACTCGAGTTGTCGTCTGTATTGGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005839
SRRM1 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-2607s21c1
Sequence:CCGGAGCCCATCACCGCCAAGAAATCTCGAGATTTCTTGGCGGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-1519s21c1
Sequence:CCGGCAGGGAGAACTTCAGGTAAAGCTCGAGCTTTACCTGAAGTTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-1605s21c1
Sequence:CCGGGAGTTATCTGAATCGGAAGAACTCGAGTTCTTCCGATTCAGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005839.3-3011s21c1
Sequence:CCGGGTTTGAGCTTTAGACTATAACCTCGAGGTTATAGTCTAAAGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-2250s21c1
Sequence:CCGGCCACAACCAAACAAACGGCATCTCGAGATGCCGTTTGTTTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1444s1c1
Sequence:CCGGGACGCCAATACAGACGACAAACTCGAGTTTGTCGTCTGTATTGGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1253s1c1
Sequence:CCGGGCAGTCAAACCGTACAAGAAACTCGAGTTTCTTGTACGGTTTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005839.x-3369s1c1
Sequence:CCGGTCATTCTGTTATTCTGGCTTCCTCGAGGAAGCCAGAATAACAGAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-2025s1c1
Sequence:CCGGCCACAACCAAACAAACGGCATCTCGAGATGCCGTTTGTTTGGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1443s1c1
Sequence:CCGGAGACGCCAATACAGACGACAACTCGAGTTGTCGTCTGTATTGGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005839
SRRM1 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-2607s21c1
Sequence:CCGGAGCCCATCACCGCCAAGAAATCTCGAGATTTCTTGGCGGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-1519s21c1
Sequence:CCGGCAGGGAGAACTTCAGGTAAAGCTCGAGCTTTACCTGAAGTTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-1605s21c1
Sequence:CCGGGAGTTATCTGAATCGGAAGAACTCGAGTTCTTCCGATTCAGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005839.3-3011s21c1
Sequence:CCGGGTTTGAGCTTTAGACTATAACCTCGAGGTTATAGTCTAAAGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005839.3-2250s21c1
Sequence:CCGGCCACAACCAAACAAACGGCATCTCGAGATGCCGTTTGTTTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1444s1c1
Sequence:CCGGGACGCCAATACAGACGACAAACTCGAGTTTGTCGTCTGTATTGGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1253s1c1
Sequence:CCGGGCAGTCAAACCGTACAAGAAACTCGAGTTTCTTGTACGGTTTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005839.x-3369s1c1
Sequence:CCGGTCATTCTGTTATTCTGGCTTCCTCGAGGAAGCCAGAATAACAGAATGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-2025s1c1
Sequence:CCGGCCACAACCAAACAAACGGCATCTCGAGATGCCGTTTGTTTGGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005839.x-1443s1c1
Sequence:CCGGAGACGCCAATACAGACGACAACTCGAGTTGTCGTCTGTATTGGCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016799
VALIDATED
SRRM1 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-2941s21c1
Sequence:CCGGGTTTGAGCTTTAGACTATAACCTCGAGGTTATAGTCTAAAGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-998s21c1
Sequence:CCGGAGATCCCGATCAAGATCATACCTCGAGGTATGATCTTGATCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-1609s21c1
Sequence:CCGGGCCCAAGAGATCCCATGTAAACTCGAGTTTACATGGGATCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-2174s21c1
Sequence:CCGGCGCTCACCACAACCAAACAAACTCGAGTTTGTTTGGTTGTGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-810s21c1
Sequence:CCGGCCACCTCTACAAGTGACATCTCTCGAGAGATGTCACTTGTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-2100s1c1
Sequence:CCGGCGCTCACCACAACCAAACAAACTCGAGTTTGTTTGGTTGTGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016799.1-2768s1c1
Sequence:CCGGGCCAGAATCAAGAGTACAAATCTCGAGATTTGTACTCTTGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-1535s1c1
Sequence:CCGGGCCCAAGAGATCCCATGTAAACTCGAGTTTACATGGGATCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016799.1-736s1c1
Sequence:CCGGCCACCTCTACAAGTGACATCTCTCGAGAGATGTCACTTGTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-737s1c1
Sequence:CCGGCACCTCTACAAGTGACATCTTCTCGAGAAGATGTCACTTGTAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016799
VALIDATED
SRRM1 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-2941s21c1
Sequence:CCGGGTTTGAGCTTTAGACTATAACCTCGAGGTTATAGTCTAAAGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-998s21c1
Sequence:CCGGAGATCCCGATCAAGATCATACCTCGAGGTATGATCTTGATCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-1609s21c1
Sequence:CCGGGCCCAAGAGATCCCATGTAAACTCGAGTTTACATGGGATCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-2174s21c1
Sequence:CCGGCGCTCACCACAACCAAACAAACTCGAGTTTGTTTGGTTGTGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-810s21c1
Sequence:CCGGCCACCTCTACAAGTGACATCTCTCGAGAGATGTCACTTGTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-2100s1c1
Sequence:CCGGCGCTCACCACAACCAAACAAACTCGAGTTTGTTTGGTTGTGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016799.1-2768s1c1
Sequence:CCGGGCCAGAATCAAGAGTACAAATCTCGAGATTTGTACTCTTGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-1535s1c1
Sequence:CCGGGCCCAAGAGATCCCATGTAAACTCGAGTTTACATGGGATCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016799.1-736s1c1
Sequence:CCGGCCACCTCTACAAGTGACATCTCTCGAGAGATGTCACTTGTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-737s1c1
Sequence:CCGGCACCTCTACAAGTGACATCTTCTCGAGAAGATGTCACTTGTAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016799
VALIDATED
SRRM1 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-2941s21c1
Sequence:CCGGGTTTGAGCTTTAGACTATAACCTCGAGGTTATAGTCTAAAGCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-998s21c1
Sequence:CCGGAGATCCCGATCAAGATCATACCTCGAGGTATGATCTTGATCGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-1609s21c1
Sequence:CCGGGCCCAAGAGATCCCATGTAAACTCGAGTTTACATGGGATCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-2174s21c1
Sequence:CCGGCGCTCACCACAACCAAACAAACTCGAGTTTGTTTGGTTGTGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016799.3-810s21c1
Sequence:CCGGCCACCTCTACAAGTGACATCTCTCGAGAGATGTCACTTGTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-2100s1c1
Sequence:CCGGCGCTCACCACAACCAAACAAACTCGAGTTTGTTTGGTTGTGGTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016799.1-2768s1c1
Sequence:CCGGGCCAGAATCAAGAGTACAAATCTCGAGATTTGTACTCTTGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-1535s1c1
Sequence:CCGGGCCCAAGAGATCCCATGTAAACTCGAGTTTACATGGGATCTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016799.1-736s1c1
Sequence:CCGGCCACCTCTACAAGTGACATCTCTCGAGAGATGTCACTTGTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016799.1-737s1c1
Sequence:CCGGCACCTCTACAAGTGACATCTTCTCGAGAAGATGTCACTTGTAGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks