EMAIL THIS PAGE TO A FRIEND

SRRM2

serine/arginine repetitive matrix 2

Synonyms: 300-KD CWF21 Cwc21 SRL300 SRm300
Gene ID:
Mouse(75956) serine/arginine repetitive matrix 2
Rat(302969) serine/arginine repetitive matrix 2
Zebrafish(553531) serine/arginine repetitive matrix 2
dog(609646) serine/arginine repetitive matrix 2
chicken(421379) serine/arginine repetitive matrix 2
naked mole-rat(101716579) serine/arginine repetitive matrix 2
domestic guinea pig(100713420) serine/arginine repetitive matrix 2
cow(539515) serine/arginine repetitive matrix 2
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175229 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175229 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175229 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046731 MISSION® esiRNA esiRNA human SRRM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016333 Rosetta Predictions human pricing
XM_001056343 Rosetta Predictions rat pricing
XM_220207 Rosetta Predictions rat pricing
NM_175229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014413 predicted 4514
2 SASI_Hs01_00014414 predicted 6618
3 SASI_Hs01_00014415 predicted 6654
4 SASI_Hs01_00014417 predicted 3004
5 SASI_Hs01_00014418 predicted 5086
6 SASI_Hs01_00014419 predicted 6248
7 SASI_Hs01_00014420 predicted 5929
8 SASI_Hs01_00014421 predicted 6798
9 SASI_Hs02_00349284 predicted 5625
10 SASI_Hs01_00014422 predicted 3601
11 SASI_Hs01_00014416 predicted 6313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282990 predicted 2464
2 SASI_Rn02_00282991 predicted 2549
3 SASI_Rn02_00282992 predicted 3426
4 SASI_Rn02_00282993 predicted 3842
5 SASI_Rn02_00282994 predicted 2439
6 SASI_Rn02_00282995 predicted 5035
7 SASI_Rn02_00282996 predicted 2748
8 SASI_Rn02_00282997 predicted 3408
9 SASI_Rn02_00282998 predicted 3930
10 SASI_Rn02_00282999 predicted 5836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379095 predicted 2410
2 SASI_Rn02_00379096 predicted 2492
3 SASI_Rn02_00379097 predicted 3373
4 SASI_Rn02_00379098 predicted 3792
5 SASI_Rn02_00379099 predicted 2375
6 SASI_Rn02_00379100 predicted 4983
7 SASI_Rn02_00379101 predicted 2694
8 SASI_Rn02_00379102 predicted 3347
9 SASI_Rn02_00379103 predicted 3875
10 SASI_Rn02_00379104 predicted 5780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033237 predicted 3621
2 SASI_Mm02_00345909 predicted 4732
3 SASI_Mm01_00033238 predicted 2220
4 SASI_Mm01_00033239 predicted 4919
5 SASI_Mm01_00033240 predicted 3092
6 SASI_Mm01_00033241 predicted 3133
7 SASI_Mm01_00033242 predicted 953
8 SASI_Mm01_00033243 predicted 5712
9 SASI_Mm01_00033244 predicted 3886
10 SASI_Mm01_00033245 predicted 5217
11 SASI_Mm01_00033246 predicted 3516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016333
VALIDATED
SRRM2 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.x-2687s1c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016333.x-2974s1c1
Sequence:CCGGCCCAAAGTGAAGGCAATAATACTCGAGTATTATTGCCTTCACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016333.x-3931s1c1
Sequence:CCGGGAAGAGTTAATGGAGGTGGTACTCGAGTACCACCTCCATTAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-2687s1c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-4060s1c1
Sequence:CCGGGCTGTGTCTTTGACTCTTGATCTCGAGATCAAGAGTCAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-4297s1c1
Sequence:CCGGCCGTTTCTTAATCAGCTGGAACTCGAGTTCCAGCTGATTAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-2630s1c1
Sequence:CCGGCCCAACCTAAAGCTAAATCTACTCGAGTAGATTTAGCTTTAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-1223s1c1
Sequence:CCGGGCCCTTATGAAGACAAAGATACTCGAGTATCTTTGTCTTCATAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016333.2-6218s1c1
Sequence:CCGGCATCTCCAGTAACTCGAAGAACTCGAGTTCTTCGAGTTACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-4621s21c1
Sequence:CCGGCCGTTTCTTAATCAGCTGGAACTCGAGTTCCAGCTGATTAAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-3298s21c1
Sequence:CCGGCCCAAAGTGAAGGCAATAATACTCGAGTATTATTGCCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-9159s21c1
Sequence:CCGGGTTGGGACTGGAGGTTGTATACTCGAGTATACAACCTCCAGTCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-3011s21c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016333
VALIDATED
SRRM2 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.x-2687s1c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016333.x-2974s1c1
Sequence:CCGGCCCAAAGTGAAGGCAATAATACTCGAGTATTATTGCCTTCACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016333.x-3931s1c1
Sequence:CCGGGAAGAGTTAATGGAGGTGGTACTCGAGTACCACCTCCATTAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-2687s1c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-4060s1c1
Sequence:CCGGGCTGTGTCTTTGACTCTTGATCTCGAGATCAAGAGTCAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-4297s1c1
Sequence:CCGGCCGTTTCTTAATCAGCTGGAACTCGAGTTCCAGCTGATTAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-2630s1c1
Sequence:CCGGCCCAACCTAAAGCTAAATCTACTCGAGTAGATTTAGCTTTAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-1223s1c1
Sequence:CCGGGCCCTTATGAAGACAAAGATACTCGAGTATCTTTGTCTTCATAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016333.2-6218s1c1
Sequence:CCGGCATCTCCAGTAACTCGAAGAACTCGAGTTCTTCGAGTTACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-4621s21c1
Sequence:CCGGCCGTTTCTTAATCAGCTGGAACTCGAGTTCCAGCTGATTAAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-3298s21c1
Sequence:CCGGCCCAAAGTGAAGGCAATAATACTCGAGTATTATTGCCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-9159s21c1
Sequence:CCGGGTTGGGACTGGAGGTTGTATACTCGAGTATACAACCTCCAGTCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-3011s21c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016333
VALIDATED
SRRM2 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.x-2687s1c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016333.x-2974s1c1
Sequence:CCGGCCCAAAGTGAAGGCAATAATACTCGAGTATTATTGCCTTCACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016333.x-3931s1c1
Sequence:CCGGGAAGAGTTAATGGAGGTGGTACTCGAGTACCACCTCCATTAACTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-2687s1c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-4060s1c1
Sequence:CCGGGCTGTGTCTTTGACTCTTGATCTCGAGATCAAGAGTCAAAGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-4297s1c1
Sequence:CCGGCCGTTTCTTAATCAGCTGGAACTCGAGTTCCAGCTGATTAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-2630s1c1
Sequence:CCGGCCCAACCTAAAGCTAAATCTACTCGAGTAGATTTAGCTTTAGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016333.2-1223s1c1
Sequence:CCGGGCCCTTATGAAGACAAAGATACTCGAGTATCTTTGTCTTCATAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016333.2-6218s1c1
Sequence:CCGGCATCTCCAGTAACTCGAAGAACTCGAGTTCTTCGAGTTACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-4621s21c1
Sequence:CCGGCCGTTTCTTAATCAGCTGGAACTCGAGTTCCAGCTGATTAAGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-3298s21c1
Sequence:CCGGCCCAAAGTGAAGGCAATAATACTCGAGTATTATTGCCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-9159s21c1
Sequence:CCGGGTTGGGACTGGAGGTTGTATACTCGAGTATACAACCTCCAGTCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016333.3-3011s21c1
Sequence:CCGGCGCCACCTAAACAGAAATCTACTCGAGTAGATTTCTGTTTAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175229
VALIDATED
SRRM2 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-8058s1c1
Sequence:CCGGCACCTCATACTCTGGAGACATCTCGAGATGTCTCCAGAGTATGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-3569s1c1
Sequence:CCGGCCAGTTTATCTCCAGAACATACTCGAGTATGTTCTGGAGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-433s1c1
Sequence:CCGGCCCAAACCATACAGCCTTGTTCTCGAGAACAAGGCTGTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-2602s1c1
Sequence:CCGGCCCAAAGTGAAGACAGTGATACTCGAGTATCACTGTCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-3568s1c1
Sequence:CCGGCCCAGTTTATCTCCAGAACATCTCGAGATGTTCTGGAGATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175229.3-8097s21c1
Sequence:CCGGCACCTCATACTCTGGAGACATCTCGAGATGTCTCCAGAGTATGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-2641s21c1
Sequence:CCGGCCCAAAGTGAAGACAGTGATACTCGAGTATCACTGTCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-3464s21c1
Sequence:CCGGTCACACCTAGAGTACTATTAACTCGAGTTAATAGTACTCTAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-2763s21c1
Sequence:CCGGCAAGGTAGACTCTAGATTAAGCTCGAGCTTAATCTAGAGTCTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-472s21c1
Sequence:CCGGCCCAAACCATACAGCCTTGTTCTCGAGAACAAGGCTGTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175229
VALIDATED
SRRM2 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-8058s1c1
Sequence:CCGGCACCTCATACTCTGGAGACATCTCGAGATGTCTCCAGAGTATGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-3569s1c1
Sequence:CCGGCCAGTTTATCTCCAGAACATACTCGAGTATGTTCTGGAGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-433s1c1
Sequence:CCGGCCCAAACCATACAGCCTTGTTCTCGAGAACAAGGCTGTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-2602s1c1
Sequence:CCGGCCCAAAGTGAAGACAGTGATACTCGAGTATCACTGTCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-3568s1c1
Sequence:CCGGCCCAGTTTATCTCCAGAACATCTCGAGATGTTCTGGAGATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175229.3-8097s21c1
Sequence:CCGGCACCTCATACTCTGGAGACATCTCGAGATGTCTCCAGAGTATGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-2641s21c1
Sequence:CCGGCCCAAAGTGAAGACAGTGATACTCGAGTATCACTGTCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-3464s21c1
Sequence:CCGGTCACACCTAGAGTACTATTAACTCGAGTTAATAGTACTCTAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-2763s21c1
Sequence:CCGGCAAGGTAGACTCTAGATTAAGCTCGAGCTTAATCTAGAGTCTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-472s21c1
Sequence:CCGGCCCAAACCATACAGCCTTGTTCTCGAGAACAAGGCTGTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175229
VALIDATED
SRRM2 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-8058s1c1
Sequence:CCGGCACCTCATACTCTGGAGACATCTCGAGATGTCTCCAGAGTATGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-3569s1c1
Sequence:CCGGCCAGTTTATCTCCAGAACATACTCGAGTATGTTCTGGAGATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-433s1c1
Sequence:CCGGCCCAAACCATACAGCCTTGTTCTCGAGAACAAGGCTGTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-2602s1c1
Sequence:CCGGCCCAAAGTGAAGACAGTGATACTCGAGTATCACTGTCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175229.2-3568s1c1
Sequence:CCGGCCCAGTTTATCTCCAGAACATCTCGAGATGTTCTGGAGATAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175229.3-8097s21c1
Sequence:CCGGCACCTCATACTCTGGAGACATCTCGAGATGTCTCCAGAGTATGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-2641s21c1
Sequence:CCGGCCCAAAGTGAAGACAGTGATACTCGAGTATCACTGTCTTCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-3464s21c1
Sequence:CCGGTCACACCTAGAGTACTATTAACTCGAGTTAATAGTACTCTAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-2763s21c1
Sequence:CCGGCAAGGTAGACTCTAGATTAAGCTCGAGCTTAATCTAGAGTCTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175229.3-472s21c1
Sequence:CCGGCCCAAACCATACAGCCTTGTTCTCGAGAACAAGGCTGTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks