EMAIL THIS PAGE TO A FRIEND

SRRM3

serine/arginine repetitive matrix 3

UniProtKB ID: A6NNA2, A6ND75
Gene ID:
Mouse(58212) serine/arginine repetitive matrix 3
Rat(685890) serine/arginine repetitive matrix 3
chicken(417516) serine/arginine repetitive matrix 3
dog(607984) serine/arginine repetitive matrix 3
cow(617590) serine/arginine repetitive matrix 3
domestic guinea pig(100729358) serine/arginine repetitive matrix 3
naked mole-rat(101715755) serine/arginine repetitive matrix 3
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153043 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039212 Rosetta Predictions human pricing
NM_001110199 Rosetta Predictions human pricing
XM_001065654 Rosetta Predictions rat pricing
NM_021403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140801 predicted 1545
2 SASI_Hs01_00140802 predicted 1300
3 SASI_Hs01_00140803 predicted 1481
4 SASI_Hs01_00140804 predicted 1230
5 SASI_Hs01_00140805 predicted 1559
6 SASI_Hs01_00140806 predicted 941
7 SASI_Hs01_00140807 predicted 1260
8 SASI_Hs01_00140808 predicted 1041
9 SASI_Hs01_00140809 predicted 1165
10 SASI_Hs01_00140810 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324845 predicted 2608
2 SASI_Hs02_00324846 predicted 2318
3 SASI_Hs02_00324847 predicted 2632
4 SASI_Hs02_00324848 predicted 2422
5 SASI_Hs02_00324849 predicted 2541
6 SASI_Hs02_00324850 predicted 2427
7 SASI_Hs02_00324851 predicted 665
8 SASI_Hs02_00324852 predicted 2347
9 SASI_Hs02_00324853 predicted 2621
10 SASI_Hs02_00324854 predicted 2522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314935 predicted 271
2 SASI_Rn02_00314936 predicted 257
3 SASI_Rn02_00314937 predicted 264
4 SASI_Rn02_00314938 predicted 197
5 SASI_Rn02_00314939 predicted 264
6 SASI_Rn02_00314940 predicted 349
7 SASI_Rn02_00314941 predicted 334
8 SASI_Rn02_00314942 predicted 351
9 SASI_Rn02_00314943 predicted 218
10 SASI_Rn02_00314944 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326029 predicted 1233
2 SASI_Mm02_00326030 predicted 1048
3 SASI_Mm01_00070056 predicted 565
4 SASI_Mm02_00326031 predicted 2619
5 SASI_Mm02_00326032 predicted 2166
6 SASI_Mm02_00326033 predicted 1231
7 SASI_Mm02_00326034 predicted 1232
8 SASI_Mm02_00326035 predicted 768
9 SASI_Mm02_00326036 predicted 1326
10 SASI_Mm02_00326037 predicted 2091
11 SASI_Mm01_00070052 predicted 602
12 SASI_Mm01_00070053 predicted 782
13 SASI_Mm01_00070054 predicted 580
14 SASI_Mm01_00070055 predicted 863
15 SASI_Mm01_00070057 predicted 761
16 SASI_Mm01_00070058 predicted 588
17 SASI_Mm01_00070059 predicted 857
18 SASI_Mm01_00070060 predicted 497
19 SASI_Mm01_00070061 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021403
SRRM3 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1185s21c1
Sequence:CCGGAGACGATACAGATCGAGAAGCCTCGAGGCTTCTCGATCTGTATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1316s21c1
Sequence:CCGGGTCCTCACACTACAGTGATTCCTCGAGGAATCACTGTAGTGTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021403.3-3543s21c1
Sequence:CCGGCACGGTCACAAGCTAACTAACCTCGAGGTTAGTTAGCTTGTGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1073s21c1
Sequence:CCGGGAGGAGACTAGAGTCAGAATGCTCGAGCATTCTGACTCTAGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021403
SRRM3 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1185s21c1
Sequence:CCGGAGACGATACAGATCGAGAAGCCTCGAGGCTTCTCGATCTGTATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1316s21c1
Sequence:CCGGGTCCTCACACTACAGTGATTCCTCGAGGAATCACTGTAGTGTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021403.3-3543s21c1
Sequence:CCGGCACGGTCACAAGCTAACTAACCTCGAGGTTAGTTAGCTTGTGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1073s21c1
Sequence:CCGGGAGGAGACTAGAGTCAGAATGCTCGAGCATTCTGACTCTAGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021403
SRRM3 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1185s21c1
Sequence:CCGGAGACGATACAGATCGAGAAGCCTCGAGGCTTCTCGATCTGTATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1316s21c1
Sequence:CCGGGTCCTCACACTACAGTGATTCCTCGAGGAATCACTGTAGTGTGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021403.3-3543s21c1
Sequence:CCGGCACGGTCACAAGCTAACTAACCTCGAGGTTAGTTAGCTTGTGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021403.3-1073s21c1
Sequence:CCGGGAGGAGACTAGAGTCAGAATGCTCGAGCATTCTGACTCTAGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153043
SRRM3 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1037s1c1
Sequence:CCGGCAAAGAGCCGTTACGAACACACTCGAGTGTGTTCGTAACGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1851s1c1
Sequence:CCGGGCATAGGATAACATGTGCTTTCTCGAGAAAGCACATGTTATCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1599s1c1
Sequence:CCGGGTACATTTGACCCTGAGGTTACTCGAGTAACCTCAGGGTCAAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1045s1c1
Sequence:CCGGCGTTACGAACACAGGAATCTCCTCGAGGAGATTCCTGTGTTCGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1034s1c1
Sequence:CCGGGAACAAAGAGCCGTTACGAACCTCGAGGTTCGTAACGGCTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1044s1c1
Sequence:CCGGCCGTTACGAACACAGGAATCTCTCGAGAGATTCCTGTGTTCGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1692s1c1
Sequence:CCGGGCAAAGTCGTTCACTGACTGACTCGAGTCAGTCAGTGAACGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1862s1c1
Sequence:CCGGCATGTGCTTTGGACCTGACAACTCGAGTTGTCAGGTCCAAAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1294s1c1
Sequence:CCGGGACAGAAGGAAGAACAGCCTACTCGAGTAGGCTGTTCTTCCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1141s1c1
Sequence:CCGGCTGCTCTGTCACTTCACCTTACTCGAGTAAGGTGAAGTGACAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153043
SRRM3 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1037s1c1
Sequence:CCGGCAAAGAGCCGTTACGAACACACTCGAGTGTGTTCGTAACGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1851s1c1
Sequence:CCGGGCATAGGATAACATGTGCTTTCTCGAGAAAGCACATGTTATCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1599s1c1
Sequence:CCGGGTACATTTGACCCTGAGGTTACTCGAGTAACCTCAGGGTCAAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1045s1c1
Sequence:CCGGCGTTACGAACACAGGAATCTCCTCGAGGAGATTCCTGTGTTCGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1034s1c1
Sequence:CCGGGAACAAAGAGCCGTTACGAACCTCGAGGTTCGTAACGGCTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1044s1c1
Sequence:CCGGCCGTTACGAACACAGGAATCTCTCGAGAGATTCCTGTGTTCGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1692s1c1
Sequence:CCGGGCAAAGTCGTTCACTGACTGACTCGAGTCAGTCAGTGAACGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1862s1c1
Sequence:CCGGCATGTGCTTTGGACCTGACAACTCGAGTTGTCAGGTCCAAAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1294s1c1
Sequence:CCGGGACAGAAGGAAGAACAGCCTACTCGAGTAGGCTGTTCTTCCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1141s1c1
Sequence:CCGGCTGCTCTGTCACTTCACCTTACTCGAGTAAGGTGAAGTGACAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153043
SRRM3 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1037s1c1
Sequence:CCGGCAAAGAGCCGTTACGAACACACTCGAGTGTGTTCGTAACGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1851s1c1
Sequence:CCGGGCATAGGATAACATGTGCTTTCTCGAGAAAGCACATGTTATCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1599s1c1
Sequence:CCGGGTACATTTGACCCTGAGGTTACTCGAGTAACCTCAGGGTCAAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1045s1c1
Sequence:CCGGCGTTACGAACACAGGAATCTCCTCGAGGAGATTCCTGTGTTCGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1034s1c1
Sequence:CCGGGAACAAAGAGCCGTTACGAACCTCGAGGTTCGTAACGGCTCTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153043.3-1044s1c1
Sequence:CCGGCCGTTACGAACACAGGAATCTCTCGAGAGATTCCTGTGTTCGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1692s1c1
Sequence:CCGGGCAAAGTCGTTCACTGACTGACTCGAGTCAGTCAGTGAACGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1862s1c1
Sequence:CCGGCATGTGCTTTGGACCTGACAACTCGAGTTGTCAGGTCCAAAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166016    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1294s1c1
Sequence:CCGGGACAGAAGGAAGAACAGCCTACTCGAGTAGGCTGTTCTTCCTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153043.3-1141s1c1
Sequence:CCGGCTGCTCTGTCACTTCACCTTACTCGAGTAAGGTGAAGTGACAGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks