EMAIL THIS PAGE TO A FRIEND

SRRM4

serine/arginine repetitive matrix 4

Synonyms: KIAA1853 MU-MB-2.76 nSR100
UniProtKB ID: A7MD48, A8K5P6, B2RZH7, Q7Z5F0, Q96JH4
Gene ID:
Human(84530) Summary: SRRM4 promotes alternative splicing and inclusion of neural-specific exons in target mRNAs (Calarco et al., 2009 [PubMed 19737518]
Mouse(68955) serine/arginine repetitive matrix 4
Rat(498189) serine/arginine repetitive matrix 4
naked mole-rat(101707440) serine/arginine repetitive matrix 4
domestic guinea pig(100731146) serine/arginine repetitive matrix 4
cow(614115) serine/arginine repetitive matrix 4
sheep(101108424) serine/arginine repetitive matrix 4
Zebrafish(796574) serine/arginine repetitive matrix 4
domestic cat(101100843) serine/arginine repetitive matrix 4
dog(611405) serine/arginine repetitive matrix 4
chicken(416989) serine/arginine repetitive matrix 4
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194286 Rosetta Predictions human pricing
XM_573405 Rosetta Predictions rat pricing
XR_009352 Rosetta Predictions rat pricing
NM_026886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189628 predicted 1023
2 SASI_Hs01_00189629 predicted 537
3 SASI_Hs01_00189630 predicted 570
4 SASI_Hs01_00189631 predicted 1368
5 SASI_Hs01_00189632 predicted 1409
6 SASI_Hs01_00189633 predicted 1542
7 SASI_Hs01_00189634 predicted 510
8 SASI_Hs01_00189635 predicted 957
9 SASI_Hs01_00189636 predicted 444
10 SASI_Hs01_00189637 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400236 predicted 369
2 SASI_Rn02_00400237 predicted 344
3 SASI_Rn02_00400238 predicted 366
4 SASI_Rn02_00400239 predicted 357
5 SASI_Rn02_00400240 predicted 356
6 SASI_Rn02_00400241 predicted 376
7 SASI_Rn02_00400242 predicted 346
8 SASI_Rn02_00400243 predicted 400
9 SASI_Rn02_00400244 predicted 382
10 SASI_Rn02_00400245 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00138559 predicted 272
2 SASI_Rn01_00138560 predicted 368
3 SASI_Rn01_00138561 predicted 346
4 SASI_Rn01_00138562 predicted 266
5 SASI_Rn01_00138563 predicted 272
6 SASI_Rn01_00138564 predicted 359
7 SASI_Rn01_00138565 predicted 299
8 SASI_Rn01_00138567 predicted 378
9 SASI_Rn01_00138568 predicted 322
10 SASI_Rn02_00419464 predicted 281
11 SASI_Rn01_00138566 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331142 predicted 381
2 SASI_Mm02_00331143 predicted 2517
3 SASI_Mm02_00331144 predicted 433
4 SASI_Mm02_00331145 predicted 2429
5 SASI_Mm02_00331146 predicted 990
6 SASI_Mm01_00189685 predicted 2424
7 SASI_Mm02_00331147 predicted 2512
8 SASI_Mm01_00189686 predicted 1406
9 SASI_Mm01_00189687 predicted 874
10 SASI_Mm02_00331148 predicted 2327
11 SASI_Mm01_00189679 predicted 360
12 SASI_Mm01_00189680 predicted 2027
13 SASI_Mm01_00189681 predicted 1037
14 SASI_Mm01_00189682 predicted 725
15 SASI_Mm01_00189683 predicted 1061
16 SASI_Mm01_00189684 predicted 496
17 SASI_Mm01_00189688 predicted 1951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194286
SRRM4 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000168199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-573s1c1
Sequence:CCGGCCTCTCATGACAAAGACTTGACTCGAGTCAAGTCTTTGTCATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-381s1c1
Sequence:CCGGGCATCATTGTCGCCAGTATCACTCGAGTGATACTGGCGACAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-788s1c1
Sequence:CCGGGAGAAGAGGCACAAGAAACAACTCGAGTTGTTTCTTGTGCCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-628s1c1
Sequence:CCGGGAAGAAATCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194286
SRRM4 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000168199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-573s1c1
Sequence:CCGGCCTCTCATGACAAAGACTTGACTCGAGTCAAGTCTTTGTCATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-381s1c1
Sequence:CCGGGCATCATTGTCGCCAGTATCACTCGAGTGATACTGGCGACAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-788s1c1
Sequence:CCGGGAGAAGAGGCACAAGAAACAACTCGAGTTGTTTCTTGTGCCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-628s1c1
Sequence:CCGGGAAGAAATCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194286
SRRM4 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000168199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-573s1c1
Sequence:CCGGCCTCTCATGACAAAGACTTGACTCGAGTCAAGTCTTTGTCATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-381s1c1
Sequence:CCGGGCATCATTGTCGCCAGTATCACTCGAGTGATACTGGCGACAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-788s1c1
Sequence:CCGGGAGAAGAGGCACAAGAAACAACTCGAGTTGTTTCTTGTGCCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194286.2-628s1c1
Sequence:CCGGGAAGAAATCCACTCGGAAGAACTCGAGTTCTTCCGAGTGGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026886
SRRM4 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-1486s1c1
Sequence:CCGGGTATGGTGAGAAAGAACCACACTCGAGTGTGGTTCTTTCTCACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026886.1-3039s1c1
Sequence:CCGGCCCAATCAAATTAGGGAAATACTCGAGTATTTCCCTAATTTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-115s1c1
Sequence:CCGGGCTGTTTGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-476s1c1
Sequence:CCGGGTCAAGAAGAAGAAGAAGAAACTCGAGTTTCTTCTTCTTCTTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026886
SRRM4 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-1486s1c1
Sequence:CCGGGTATGGTGAGAAAGAACCACACTCGAGTGTGGTTCTTTCTCACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026886.1-3039s1c1
Sequence:CCGGCCCAATCAAATTAGGGAAATACTCGAGTATTTCCCTAATTTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-115s1c1
Sequence:CCGGGCTGTTTGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-476s1c1
Sequence:CCGGGTCAAGAAGAAGAAGAAGAAACTCGAGTTTCTTCTTCTTCTTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026886
SRRM4 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-1486s1c1
Sequence:CCGGGTATGGTGAGAAAGAACCACACTCGAGTGTGGTTCTTTCTCACCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026886.1-3039s1c1
Sequence:CCGGCCCAATCAAATTAGGGAAATACTCGAGTATTTCCCTAATTTGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-115s1c1
Sequence:CCGGGCTGTTTGAGAAGTTCTGGAACTCGAGTTCCAGAACTTCTCAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026886.1-476s1c1
Sequence:CCGGGTCAAGAAGAAGAAGAAGAAACTCGAGTTTCTTCTTCTTCTTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks