EMAIL THIS PAGE TO A FRIEND

SRRM5

serine/arginine repetitive matrix 5

Synonyms: ZNF576
UniProtKB ID: B3KS81, B4DNF0
Gene ID:
Rat(100363433) serine/arginine repetitive matrix 5
cow(101902518) serine/arginine repetitive matrix 5
5 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047399 Anti-SRRM5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145641 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145641
SRRM5 MISSION shRNA Bacterial Glycerol Stock
serine/arginine repetitive matrix 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-201s21c1
Sequence:CCGGCAGTTCCAAGTCCACCAAATCCTCGAGGATTTGGTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-663s21c1
Sequence:CCGGCAGTACAGCCAAGTGTCAAACCTCGAGGTTTGACACTTGGCTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-1997s21c1
Sequence:CCGGCAAGCAGTCTCAGTCAGAATACTCGAGTATTCTGACTGAGACTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-808s21c1
Sequence:CCGGTCCAGCAGGGTCAAGAGTTATCTCGAGATAACTCTTGACCCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-571s21c1
Sequence:CCGGAGTGACAGCCAGCCTAGAAATCTCGAGATTTCTAGGCTGGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145641
SRRM5 MISSION shRNA shRNA Plasmid DNA
serine/arginine repetitive matrix 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-201s21c1
Sequence:CCGGCAGTTCCAAGTCCACCAAATCCTCGAGGATTTGGTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-663s21c1
Sequence:CCGGCAGTACAGCCAAGTGTCAAACCTCGAGGTTTGACACTTGGCTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-1997s21c1
Sequence:CCGGCAAGCAGTCTCAGTCAGAATACTCGAGTATTCTGACTGAGACTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-808s21c1
Sequence:CCGGTCCAGCAGGGTCAAGAGTTATCTCGAGATAACTCTTGACCCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-571s21c1
Sequence:CCGGAGTGACAGCCAGCCTAGAAATCTCGAGATTTCTAGGCTGGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145641
SRRM5 MISSION shRNA Lentiviral Transduction Particles
serine/arginine repetitive matrix 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-201s21c1
Sequence:CCGGCAGTTCCAAGTCCACCAAATCCTCGAGGATTTGGTGGACTTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-663s21c1
Sequence:CCGGCAGTACAGCCAAGTGTCAAACCTCGAGGTTTGACACTTGGCTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-1997s21c1
Sequence:CCGGCAAGCAGTCTCAGTCAGAATACTCGAGTATTCTGACTGAGACTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-808s21c1
Sequence:CCGGTCCAGCAGGGTCAAGAGTTATCTCGAGATAACTCTTGACCCTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145641.1-571s21c1
Sequence:CCGGAGTGACAGCCAGCCTAGAAATCTCGAGATTTCTAGGCTGGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks