EMAIL THIS PAGE TO A FRIEND

SRRT

serrate RNA effector molecule homolog (Arabidopsis)

Synonyms: ARS2 ASR2 serrate
Gene ID:
Mouse(83701) serrate RNA effector molecule homolog (Arabidopsis)
Zebrafish(192311) serrate RNA effector molecule homolog (Arabidopsis)
domestic cat(101101181) serrate RNA effector molecule homolog (Arabidopsis)
Horse(100067574) serrate RNA effector molecule homolog (Arabidopsis)
dog(479731) serrate RNA effector molecule homolog (Arabidopsis)
domestic guinea pig(100731742) serrate RNA effector molecule homolog (Arabidopsis)
naked mole-rat(101707531) serrate RNA effector molecule homolog (Arabidopsis)
cow(527938) serrate RNA effector molecule homolog (Arabidopsis)
sheep(101123523) serrate RNA effector molecule homolog (Arabidopsis)
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015908 Rosetta Predictions human pricing
NM_182800 Rosetta Predictions human pricing
NM_001109909 Rosetta Predictions mouse pricing
NM_001109910 Rosetta Predictions mouse pricing
NM_031405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120002 predicted 2402
2 SASI_Hs01_00120004 predicted 2415
3 SASI_Hs01_00120005 predicted 1638
4 SASI_Hs02_00348506 predicted 1909
5 SASI_Hs01_00120006 predicted 2078
6 SASI_Hs01_00120007 predicted 1917
7 SASI_Hs01_00120008 predicted 810
8 SASI_Hs02_00348507 predicted 2255
9 SASI_Hs01_00120009 predicted 2139
10 SASI_Hs01_00120010 predicted 1889
11 SASI_Hs01_00120003 predicted 774
12 SASI_Hs01_00120011 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078780 predicted 2470
2 SASI_Hs01_00078782 predicted 2487
3 SASI_Hs01_00078783 predicted 1706
4 SASI_Hs02_00370949 predicted 1983
5 SASI_Hs01_00078784 predicted 2157
6 SASI_Hs01_00078785 predicted 1983
7 SASI_Hs01_00078786 predicted 883
8 SASI_Hs02_00370950 predicted 2325
9 SASI_Hs01_00078787 predicted 2210
10 SASI_Hs01_00078788 predicted 1961
11 SASI_Hs01_00078781 predicted 854
12 SASI_Hs01_00078789 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304414 predicted 2218
2 SASI_Mm02_00304415 predicted 2279
3 SASI_Mm02_00304416 predicted 1047
4 SASI_Mm02_00304417 predicted 963
5 SASI_Mm02_00304418 predicted 2235
6 SASI_Mm02_00304419 predicted 1728
7 SASI_Mm02_00304420 predicted 2295
8 SASI_Mm02_00304421 predicted 1002
9 SASI_Mm02_00304422 predicted 2258
10 SASI_Mm02_00304423 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304424 predicted 2212
2 SASI_Mm02_00304425 predicted 2277
3 SASI_Mm02_00304426 predicted 1050
4 SASI_Mm02_00304427 predicted 959
5 SASI_Mm02_00304428 predicted 2226
6 SASI_Mm02_00304429 predicted 1733
7 SASI_Mm02_00304430 predicted 2294
8 SASI_Mm02_00304431 predicted 993
9 SASI_Mm02_00304432 predicted 2263
10 SASI_Mm02_00304433 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182723 predicted 2218
2 SASI_Mm01_00182724 predicted 2278
3 SASI_Mm01_00182725 predicted 1044
4 SASI_Mm02_00337154 predicted 954
5 SASI_Mm01_00182726 predicted 2228
6 SASI_Mm01_00182728 predicted 1732
7 SASI_Mm01_00182730 predicted 2290
8 SASI_Mm02_00337155 predicted 1000
9 SASI_Mm02_00337156 predicted 2261
10 SASI_Mm02_00337157 predicted 2113
11 SASI_Mm01_00182721 predicted 1820
12 SASI_Mm01_00182722 predicted 1561
13 SASI_Mm01_00182727 predicted 1518
14 SASI_Mm01_00182729 predicted 1291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015908
VALIDATED
SRRT MISSION shRNA Bacterial Glycerol Stock
serrate RNA effector molecule homolog (Arabidopsis)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015908.5-768s21c1
Sequence:CCGGAGGCCGTCAAGCGCTATAATGCTCGAGCATTATAGCGCTTGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-2121s21c1
Sequence:CCGGTCGTGCATTCCTTGGATTATTCTCGAGAATAATCCAAGGAATGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-1676s21c1
Sequence:CCGGGACCGCAGTGTTAACATTAAACTCGAGTTTAATGTTAACACTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015908.5-1001s21c1
Sequence:CCGGGCCATTGTCAAGATGCTGGATCTCGAGATCCAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-2067s21c1
Sequence:CCGGAGCGGGATGAGAAGTTGATTACTCGAGTAATCAACTTCTCATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-2417s1c1
Sequence:CCGGGCGCAAACATATCTTCAACAACTCGAGTTGTTGAAGATATGTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-1176s1c1
Sequence:CCGGGCTGAGAATGACAGTTCTAATCTCGAGATTAGAACTGTCATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015908.4-1013s1c1
Sequence:CCGGCACGGAGAATGATCTTCGCATCTCGAGATGCGAAGATCATTCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-966s1c1
Sequence:CCGGGCCATTGTCAAGATGCTGGATCTCGAGATCCAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015908.4-2841s1c1
Sequence:CCGGCCAGACGATGTTGATTTCTTTCTCGAGAAAGAAATCAACATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015908
VALIDATED
SRRT MISSION shRNA shRNA Plasmid DNA
serrate RNA effector molecule homolog (Arabidopsis)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015908.5-768s21c1
Sequence:CCGGAGGCCGTCAAGCGCTATAATGCTCGAGCATTATAGCGCTTGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-2121s21c1
Sequence:CCGGTCGTGCATTCCTTGGATTATTCTCGAGAATAATCCAAGGAATGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-1676s21c1
Sequence:CCGGGACCGCAGTGTTAACATTAAACTCGAGTTTAATGTTAACACTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015908.5-1001s21c1
Sequence:CCGGGCCATTGTCAAGATGCTGGATCTCGAGATCCAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-2067s21c1
Sequence:CCGGAGCGGGATGAGAAGTTGATTACTCGAGTAATCAACTTCTCATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-2417s1c1
Sequence:CCGGGCGCAAACATATCTTCAACAACTCGAGTTGTTGAAGATATGTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-1176s1c1
Sequence:CCGGGCTGAGAATGACAGTTCTAATCTCGAGATTAGAACTGTCATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015908.4-1013s1c1
Sequence:CCGGCACGGAGAATGATCTTCGCATCTCGAGATGCGAAGATCATTCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-966s1c1
Sequence:CCGGGCCATTGTCAAGATGCTGGATCTCGAGATCCAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015908.4-2841s1c1
Sequence:CCGGCCAGACGATGTTGATTTCTTTCTCGAGAAAGAAATCAACATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015908
VALIDATED
SRRT MISSION shRNA Lentiviral Transduction Particles
serrate RNA effector molecule homolog (Arabidopsis)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015908.5-768s21c1
Sequence:CCGGAGGCCGTCAAGCGCTATAATGCTCGAGCATTATAGCGCTTGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-2121s21c1
Sequence:CCGGTCGTGCATTCCTTGGATTATTCTCGAGAATAATCCAAGGAATGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-1676s21c1
Sequence:CCGGGACCGCAGTGTTAACATTAAACTCGAGTTTAATGTTAACACTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015908.5-1001s21c1
Sequence:CCGGGCCATTGTCAAGATGCTGGATCTCGAGATCCAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015908.5-2067s21c1
Sequence:CCGGAGCGGGATGAGAAGTTGATTACTCGAGTAATCAACTTCTCATCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-2417s1c1
Sequence:CCGGGCGCAAACATATCTTCAACAACTCGAGTTGTTGAAGATATGTTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-1176s1c1
Sequence:CCGGGCTGAGAATGACAGTTCTAATCTCGAGATTAGAACTGTCATTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015908.4-1013s1c1
Sequence:CCGGCACGGAGAATGATCTTCGCATCTCGAGATGCGAAGATCATTCTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015908.4-966s1c1
Sequence:CCGGGCCATTGTCAAGATGCTGGATCTCGAGATCCAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015908.4-2841s1c1
Sequence:CCGGCCAGACGATGTTGATTTCTTTCTCGAGAAAGAAATCAACATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031405
VALIDATED
SRRT MISSION shRNA Bacterial Glycerol Stock
serrate RNA effector molecule homolog (Arabidopsis)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-733s1c1
Sequence:CCGGGCCATTGTCAAGATGCTAGATCTCGAGATCTAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031405.1-2236s1c1
Sequence:CCGGGTGGCGTTCTTCAATAACTTTCTCGAGAAAGTTATTGAAGAACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-1507s1c1
Sequence:CCGGGTCCGCAACATAAATGGCATTCTCGAGAATGCCATTTATGTTGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-499s1c1
Sequence:CCGGGAGGCAGTTAAACGCTACAATCTCGAGATTGTAGCGTTTAACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031405.1-1508s1c1
Sequence:CCGGTCCGCAACATAAATGGCATTACTCGAGTAATGCCATTTATGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031405
VALIDATED
SRRT MISSION shRNA shRNA Plasmid DNA
serrate RNA effector molecule homolog (Arabidopsis)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-733s1c1
Sequence:CCGGGCCATTGTCAAGATGCTAGATCTCGAGATCTAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031405.1-2236s1c1
Sequence:CCGGGTGGCGTTCTTCAATAACTTTCTCGAGAAAGTTATTGAAGAACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-1507s1c1
Sequence:CCGGGTCCGCAACATAAATGGCATTCTCGAGAATGCCATTTATGTTGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-499s1c1
Sequence:CCGGGAGGCAGTTAAACGCTACAATCTCGAGATTGTAGCGTTTAACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031405.1-1508s1c1
Sequence:CCGGTCCGCAACATAAATGGCATTACTCGAGTAATGCCATTTATGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031405
VALIDATED
SRRT MISSION shRNA Lentiviral Transduction Particles
serrate RNA effector molecule homolog (Arabidopsis)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-733s1c1
Sequence:CCGGGCCATTGTCAAGATGCTAGATCTCGAGATCTAGCATCTTGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031405.1-2236s1c1
Sequence:CCGGGTGGCGTTCTTCAATAACTTTCTCGAGAAAGTTATTGAAGAACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-1507s1c1
Sequence:CCGGGTCCGCAACATAAATGGCATTCTCGAGAATGCCATTTATGTTGCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031405.1-499s1c1
Sequence:CCGGGAGGCAGTTAAACGCTACAATCTCGAGATTGTAGCGTTTAACTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031405.1-1508s1c1
Sequence:CCGGTCCGCAACATAAATGGCATTACTCGAGTAATGCCATTTATGTTGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks