EMAIL THIS PAGE TO A FRIEND

SRSF10

serine/arginine-rich splicing factor 10

Synonyms: FUSIP1 FUSIP2 NSSR SFRS13 SFRS13A SRp38 SRrp40 TASR TASR1 TASR2
Gene ID:
Human(10772) Summary: This gene product is a member of the serine-arginine (SR) family of proteins, which is involved in constitutive and regulated RNA splicing. Members of this family are characterized by N-terminal RNP1 and RNP2 motifs, which are required for binding to RNA, and multiple C-terminal SR/RS repeats, which are important in mediating association with other cellular proteins. This protein can influence splice site selection of adenovirus E1A pre-mRNA. It interacts with the oncoprotein TLS, and abrogates the influence of TLS on E1A pre-mRNA splicing. This gene has multiple pseudogenes. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. In addition, transcript variants utilizing alternative polyA sites exist.[provided by RefSeq, Jul 2010]
Mouse(14105) serine/arginine-rich splicing factor 10
Rat(362630) serine/arginine-rich splicing factor 10
domestic guinea pig(100721249) serine/arginine-rich splicing factor 10
naked mole-rat(101718912) serine/arginine-rich splicing factor 10
sheep(101120394) serine/arginine-rich splicing factor 10
chicken(419689) serine/arginine-rich splicing factor 10
dog(610494) serine/arginine-rich splicing factor 10
domestic cat(101096746) serine/arginine-rich splicing factor 10
Horse(100071526) serine/arginine-rich splicing factor 10
247 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006625 Rosetta Predictions human pricing
NM_054016 Rosetta Predictions human pricing
NM_001025738 Rosetta Predictions rat pricing
NM_001080387 Rosetta Predictions mouse pricing
NM_010178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162140 predicted 264
2 SASI_Hs01_00162149 predicted 347
3 SASI_Hs01_00162141 predicted 308
4 SASI_Hs01_00162142 predicted 301
5 SASI_Hs01_00162143 predicted 293
6 SASI_Hs01_00162144 predicted 288
7 SASI_Hs01_00162145 predicted 296
8 SASI_Hs01_00162146 predicted 339
9 SASI_Hs01_00162147 predicted 258
10 SASI_Hs01_00162148 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145463 predicted 263
2 SASI_Hs01_00145472 predicted 347
3 SASI_Hs01_00145464 predicted 304
4 SASI_Hs01_00145465 predicted 301
5 SASI_Hs01_00145466 predicted 299
6 SASI_Hs01_00145467 predicted 289
7 SASI_Hs01_00145468 predicted 294
8 SASI_Hs01_00145469 predicted 335
9 SASI_Hs01_00145470 predicted 264
10 SASI_Hs01_00145471 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057692 predicted 239
2 SASI_Rn01_00057693 predicted 282
3 SASI_Rn01_00057694 predicted 567
4 SASI_Rn01_00057695 predicted 317
5 SASI_Rn02_00203376 predicted 382
6 SASI_Rn01_00057696 predicted 508
7 SASI_Rn01_00057697 predicted 863
8 SASI_Rn01_00057698 predicted 688
9 SASI_Rn01_00057699 predicted 429
10 SASI_Rn01_00057701 predicted 408
11 SASI_Rn01_00057700 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293423 predicted 324
2 SASI_Mm02_00293424 predicted 546
3 SASI_Mm02_00293425 predicted 282
4 SASI_Mm02_00293426 predicted 217
5 SASI_Mm02_00293427 predicted 777
6 SASI_Mm02_00293428 predicted 719
7 SASI_Mm02_00293429 predicted 234
8 SASI_Mm02_00293430 predicted 945
9 SASI_Mm02_00293431 predicted 831
10 SASI_Mm02_00293432 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173938 predicted 323
2 SASI_Mm02_00317963 predicted 226
3 SASI_Mm02_00317964 predicted 225
4 SASI_Mm02_00317965 predicted 396
5 SASI_Mm02_00317966 predicted 323
6 SASI_Mm02_00317967 predicted 279
7 SASI_Mm01_00173944 predicted 359
8 SASI_Mm02_00317968 predicted 278
9 SASI_Mm02_00317969 predicted 226
10 SASI_Mm02_00317970 predicted 204
11 SASI_Mm01_00173939 predicted 489
12 SASI_Mm01_00173940 predicted 345
13 SASI_Mm01_00173941 predicted 218
14 SASI_Mm01_00173942 predicted 685
15 SASI_Mm01_00173943 predicted 577
16 SASI_Mm01_00173945 predicted 641
17 SASI_Mm01_00173946 predicted 268
18 SASI_Mm01_00173947 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006625
VALIDATED
SRSF10 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-260s21c1
Sequence:CCGGCGTGATGCTGAAGACGCTTTACTCGAGTAAAGCGTCTTCAGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006625.3-1157s21c1
Sequence:CCGGCCAGGTAAATTCCAATTATATCTCGAGATATAATTGGAATTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-428s21c1
Sequence:CCGGCGTTCTAGAAGCCGAAGTTATCTCGAGATAACTTCGGCTTCTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-483s21c1
Sequence:CCGGACAACTATAGAAGATCGTATACTCGAGTATACGATCTTCTATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006625.3-1156s1c1
Sequence:CCGGCCCAGGTAAATTCCAATTATACTCGAGTATAATTGGAATTTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-155s1c1
Sequence:CCGGCGGCGTGAATTTGGTCGTTATCTCGAGATAACGACCAAATTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006625.3-402s1c1
Sequence:CCGGGCTATGATGATTATGACAGATCTCGAGATCTGTCATAATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-438s1c1
Sequence:CCGGGCCGAAGTTATGAAAGGAGGACTCGAGTCCTCCTTTCATAACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-589s1c1
Sequence:CCGGCCAGTACAGTTCTGCTTACTACTCGAGTAGTAAGCAGAACTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006625
VALIDATED
SRSF10 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-260s21c1
Sequence:CCGGCGTGATGCTGAAGACGCTTTACTCGAGTAAAGCGTCTTCAGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006625.3-1157s21c1
Sequence:CCGGCCAGGTAAATTCCAATTATATCTCGAGATATAATTGGAATTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-428s21c1
Sequence:CCGGCGTTCTAGAAGCCGAAGTTATCTCGAGATAACTTCGGCTTCTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-483s21c1
Sequence:CCGGACAACTATAGAAGATCGTATACTCGAGTATACGATCTTCTATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006625.3-1156s1c1
Sequence:CCGGCCCAGGTAAATTCCAATTATACTCGAGTATAATTGGAATTTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-155s1c1
Sequence:CCGGCGGCGTGAATTTGGTCGTTATCTCGAGATAACGACCAAATTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006625.3-402s1c1
Sequence:CCGGGCTATGATGATTATGACAGATCTCGAGATCTGTCATAATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-438s1c1
Sequence:CCGGGCCGAAGTTATGAAAGGAGGACTCGAGTCCTCCTTTCATAACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-589s1c1
Sequence:CCGGCCAGTACAGTTCTGCTTACTACTCGAGTAGTAAGCAGAACTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006625
VALIDATED
SRSF10 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-260s21c1
Sequence:CCGGCGTGATGCTGAAGACGCTTTACTCGAGTAAAGCGTCTTCAGCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006625.3-1157s21c1
Sequence:CCGGCCAGGTAAATTCCAATTATATCTCGAGATATAATTGGAATTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-428s21c1
Sequence:CCGGCGTTCTAGAAGCCGAAGTTATCTCGAGATAACTTCGGCTTCTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006625.3-483s21c1
Sequence:CCGGACAACTATAGAAGATCGTATACTCGAGTATACGATCTTCTATAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006625.3-1156s1c1
Sequence:CCGGCCCAGGTAAATTCCAATTATACTCGAGTATAATTGGAATTTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-155s1c1
Sequence:CCGGCGGCGTGAATTTGGTCGTTATCTCGAGATAACGACCAAATTCACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006625.3-402s1c1
Sequence:CCGGGCTATGATGATTATGACAGATCTCGAGATCTGTCATAATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-438s1c1
Sequence:CCGGGCCGAAGTTATGAAAGGAGGACTCGAGTCCTCCTTTCATAACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006625.3-589s1c1
Sequence:CCGGCCAGTACAGTTCTGCTTACTACTCGAGTAGTAAGCAGAACTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010178
VALIDATED
SRSF10 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010178.1-2964s1c1
Sequence:CCGGGCCAGGAATCAGAGAGGTTAACTCGAGTTAACCTCTCTGATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-571s1c1
Sequence:CCGGGCTGGAATACCCAGTACAGTTCTCGAGAACTGTACTGGGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010178.1-502s1c1
Sequence:CCGGGAAACAGTAGACCGACTGGAACTCGAGTTCCAGTCGGTCTACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-147s1c1
Sequence:CCGGCGTCGGGAATTTGGTCGTTATCTCGAGATAACGACCAAATTCCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-547s1c1
Sequence:CCGGCCGACAATGATAGACCAAACTCTCGAGAGTTTGGTCTATCATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010178
VALIDATED
SRSF10 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010178.1-2964s1c1
Sequence:CCGGGCCAGGAATCAGAGAGGTTAACTCGAGTTAACCTCTCTGATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-571s1c1
Sequence:CCGGGCTGGAATACCCAGTACAGTTCTCGAGAACTGTACTGGGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010178.1-502s1c1
Sequence:CCGGGAAACAGTAGACCGACTGGAACTCGAGTTCCAGTCGGTCTACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-147s1c1
Sequence:CCGGCGTCGGGAATTTGGTCGTTATCTCGAGATAACGACCAAATTCCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-547s1c1
Sequence:CCGGCCGACAATGATAGACCAAACTCTCGAGAGTTTGGTCTATCATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010178
VALIDATED
SRSF10 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010178.1-2964s1c1
Sequence:CCGGGCCAGGAATCAGAGAGGTTAACTCGAGTTAACCTCTCTGATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-571s1c1
Sequence:CCGGGCTGGAATACCCAGTACAGTTCTCGAGAACTGTACTGGGTATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010178.1-502s1c1
Sequence:CCGGGAAACAGTAGACCGACTGGAACTCGAGTTCCAGTCGGTCTACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-147s1c1
Sequence:CCGGCGTCGGGAATTTGGTCGTTATCTCGAGATAACGACCAAATTCCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010178.1-547s1c1
Sequence:CCGGCCGACAATGATAGACCAAACTCTCGAGAGTTTGGTCTATCATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks