EMAIL THIS PAGE TO A FRIEND

SRSF11

serine/arginine-rich splicing factor 11

Synonyms: NET2 SFRS11 dJ677H15.2 p54
UniProtKB ID: Q05519, Q5T758, Q8IWE6
Gene ID:
Human(9295) Summary: This gene encodes 54-kD nuclear protein that contains an arginine/serine-rich region similar to segments found in pre-mRNA splicing factors. Although the function of this protein is not yet known, structure and immunolocalization data suggest that it may play a role in pre-mRNA processing. Alternative splicing results in multiple transcript variants encoding different proteins. In addition, a pseudogene of this gene has been found on chromosome 12.[provided by RefSeq, Sep 2010]
Mouse(69207) serine/arginine-rich splicing factor 11
Rat(502603) serine/arginine-rich splicing factor 11
Zebrafish(321886) serine/arginine-rich splicing factor 11
Horse(100068423) serine/arginine-rich splicing factor 11
domestic cat(101087506) serine/arginine-rich splicing factor 11
dog(490216) serine/arginine-rich splicing factor 11
chicken(424714) serine/arginine-rich splicing factor 11
cow(513451) serine/arginine-rich splicing factor 11
sheep(101117976) serine/arginine-rich splicing factor 11
naked mole-rat(101719677) serine/arginine-rich splicing factor 11
domestic guinea pig(100718168) serine/arginine-rich splicing factor 11
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026989 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026989 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026989 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004768 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004768 Rosetta Predictions human pricing
NM_001035255 Rosetta Predictions rat pricing
NM_001093752 Rosetta Predictions mouse pricing
NM_001093753 Rosetta Predictions mouse pricing
NM_026989 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099955 predicted 808
2 SASI_Hs01_00099956 predicted 465
3 SASI_Hs02_00338268 predicted 754
4 SASI_Hs01_00099957 predicted 1708
5 SASI_Hs02_00338269 predicted 635
6 SASI_Hs02_00338270 predicted 1709
7 SASI_Hs01_00099958 predicted 774
8 SASI_Hs01_00099960 predicted 503
9 SASI_Hs01_00099961 predicted 732
10 SASI_Hs02_00338271 predicted 548
11 SASI_Hs01_00099952 predicted 1674
12 SASI_Hs01_00099953 predicted 1765
13 SASI_Hs01_00099954 predicted 671
14 SASI_Hs01_00099959 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109993 predicted 633
2 SASI_Rn01_00109995 predicted 384
3 SASI_Rn01_00109996 predicted 363
4 SASI_Rn01_00109997 predicted 601
5 SASI_Rn01_00109998 predicted 430
6 SASI_Rn02_00204210 predicted 419
7 SASI_Rn01_00109999 predicted 464
8 SASI_Rn02_00204211 predicted 443
9 SASI_Rn01_00110000 predicted 744
10 SASI_Rn01_00110001 predicted 786
11 SASI_Rn01_00109994 predicted 1583
12 SASI_Rn01_00110002 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301049 predicted 1690
2 SASI_Mm02_00301050 predicted 686
3 SASI_Mm02_00301051 predicted 1623
4 SASI_Mm02_00301052 predicted 667
5 SASI_Mm02_00301053 predicted 954
6 SASI_Mm02_00301054 predicted 1665
7 SASI_Mm02_00301055 predicted 1640
8 SASI_Mm02_00301056 predicted 781
9 SASI_Mm02_00301057 predicted 816
10 SASI_Mm02_00301058 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301059 predicted 653
2 SASI_Mm02_00301060 predicted 1668
3 SASI_Mm02_00301061 predicted 799
4 SASI_Mm02_00301062 predicted 1476
5 SASI_Mm02_00301063 predicted 788
6 SASI_Mm02_00301064 predicted 1514
7 SASI_Mm02_00301065 predicted 1519
8 SASI_Mm02_00301066 predicted 640
9 SASI_Mm02_00301067 predicted 1652
10 SASI_Mm02_00301068 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135176 predicted 691
2 SASI_Mm02_00331329 predicted 1710
3 SASI_Mm02_00331330 predicted 1794
4 SASI_Mm02_00331331 predicted 1511
5 SASI_Mm02_00331332 predicted 821
6 SASI_Mm02_00331333 predicted 1555
7 SASI_Mm02_00331334 predicted 1556
8 SASI_Mm02_00331335 predicted 681
9 SASI_Mm02_00331336 predicted 1686
10 SASI_Mm02_00331337 predicted 688
11 SASI_Mm01_00135174 predicted 501
12 SASI_Mm01_00135175 predicted 1439
13 SASI_Mm01_00135177 predicted 259
14 SASI_Mm01_00135178 predicted 772
15 SASI_Mm01_00135179 predicted 269
16 SASI_Mm01_00135180 predicted 306
17 SASI_Mm01_00135181 predicted 657
18 SASI_Mm01_00135182 predicted 1456
19 SASI_Mm01_00135183 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026989
VALIDATED
SRSF11 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026989.1-2299s1c1
Sequence:CCGGGCACAGTGATTCCATGTTATACTCGAGTATAACATGGAATCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-263s1c1
Sequence:CCGGGAGTTATTCCTGATGAGACTACTCGAGTAGTCTCATCAGGAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-1314s1c1
Sequence:CCGGCCTTCGAGAGTCCAAAGTGAACTCGAGTTCACTTTGGACTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-172s1c1
Sequence:CCGGGTGGTGTATCAGGGAGACATTCTCGAGAATGTCTCCCTGATACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026989.1-1085s1c1
Sequence:CCGGGCAGAGATGAAAGGGAACGATCTCGAGATCGTTCCCTTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-827s21c1
Sequence:CCGGCCCTGATTTCTGCCGCTATTGCTCGAGCAATAGCGGCAGAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026989.3-350s21c1
Sequence:CCGGTTAGCGAACATAAGTACTTTCCTCGAGGAAAGTACTTATGTTCGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1373s21c1
Sequence:CCGGAGAGTGACAAAGACGTCAAACCTCGAGGTTTGACGTCTTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1979s21c1
Sequence:CCGGTCTGACACGGTGACCTATTTACTCGAGTAAATAGGTCACCGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1295s21c1
Sequence:CCGGGCAGAGATGAAAGGGAACGATCTCGAGATCGTTCCCTTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026989
VALIDATED
SRSF11 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026989.1-2299s1c1
Sequence:CCGGGCACAGTGATTCCATGTTATACTCGAGTATAACATGGAATCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-263s1c1
Sequence:CCGGGAGTTATTCCTGATGAGACTACTCGAGTAGTCTCATCAGGAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-1314s1c1
Sequence:CCGGCCTTCGAGAGTCCAAAGTGAACTCGAGTTCACTTTGGACTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-172s1c1
Sequence:CCGGGTGGTGTATCAGGGAGACATTCTCGAGAATGTCTCCCTGATACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026989.1-1085s1c1
Sequence:CCGGGCAGAGATGAAAGGGAACGATCTCGAGATCGTTCCCTTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-827s21c1
Sequence:CCGGCCCTGATTTCTGCCGCTATTGCTCGAGCAATAGCGGCAGAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026989.3-350s21c1
Sequence:CCGGTTAGCGAACATAAGTACTTTCCTCGAGGAAAGTACTTATGTTCGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1373s21c1
Sequence:CCGGAGAGTGACAAAGACGTCAAACCTCGAGGTTTGACGTCTTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1979s21c1
Sequence:CCGGTCTGACACGGTGACCTATTTACTCGAGTAAATAGGTCACCGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1295s21c1
Sequence:CCGGGCAGAGATGAAAGGGAACGATCTCGAGATCGTTCCCTTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026989
VALIDATED
SRSF11 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026989.1-2299s1c1
Sequence:CCGGGCACAGTGATTCCATGTTATACTCGAGTATAACATGGAATCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-263s1c1
Sequence:CCGGGAGTTATTCCTGATGAGACTACTCGAGTAGTCTCATCAGGAATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-1314s1c1
Sequence:CCGGCCTTCGAGAGTCCAAAGTGAACTCGAGTTCACTTTGGACTCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026989.1-172s1c1
Sequence:CCGGGTGGTGTATCAGGGAGACATTCTCGAGAATGTCTCCCTGATACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026989.1-1085s1c1
Sequence:CCGGGCAGAGATGAAAGGGAACGATCTCGAGATCGTTCCCTTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-827s21c1
Sequence:CCGGCCCTGATTTCTGCCGCTATTGCTCGAGCAATAGCGGCAGAAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026989.3-350s21c1
Sequence:CCGGTTAGCGAACATAAGTACTTTCCTCGAGGAAAGTACTTATGTTCGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1373s21c1
Sequence:CCGGAGAGTGACAAAGACGTCAAACCTCGAGGTTTGACGTCTTTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1979s21c1
Sequence:CCGGTCTGACACGGTGACCTATTTACTCGAGTAAATAGGTCACCGTGTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026989.3-1295s21c1
Sequence:CCGGGCAGAGATGAAAGGGAACGATCTCGAGATCGTTCCCTTTCATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004768
VALIDATED
SRSF11 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004768.x-2400s1c1
Sequence:CCGGCCTTATCTCTTGCCCTTATTTCTCGAGAAATAAGGGCAAGAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004768.x-814s1c1
Sequence:CCGGGTCCCTAATTTCTGCTGCTATCTCGAGATAGCAGCAGAAATTAGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004768.x-432s1c1
Sequence:CCGGGAGCTTTGATAGTCGTACCATCTCGAGATGGTACGACTATCAAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004768.x-433s1c1
Sequence:CCGGAGCTTTGATAGTCGTACCATACTCGAGTATGGTACGACTATCAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004768.x-1297s1c1
Sequence:CCGGAGAACGATCAACAAGCAAGAACTCGAGTTCTTGCTTGTTGATCGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-432s21c1
Sequence:CCGGGAGCTTTGATAGTCGTACCATCTCGAGATGGTACGACTATCAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-222s21c1
Sequence:CCGGAGGTAATCCAGGTGACTAATGCTCGAGCATTAGTCACCTGGATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1562s21c1
Sequence:CCGGATGGATATGAGTGACTGAATACTCGAGTATTCAGTCACTCATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1703s21c1
Sequence:CCGGTAAAGCTCCTGTTACTCATATCTCGAGATATGAGTAACAGGAGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1501s21c1
Sequence:CCGGGGGAACTGGTGATTCACTAAGCTCGAGCTTAGTGAATCACCAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004768
VALIDATED
SRSF11 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004768.x-2400s1c1
Sequence:CCGGCCTTATCTCTTGCCCTTATTTCTCGAGAAATAAGGGCAAGAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004768.x-814s1c1
Sequence:CCGGGTCCCTAATTTCTGCTGCTATCTCGAGATAGCAGCAGAAATTAGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004768.x-432s1c1
Sequence:CCGGGAGCTTTGATAGTCGTACCATCTCGAGATGGTACGACTATCAAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004768.x-433s1c1
Sequence:CCGGAGCTTTGATAGTCGTACCATACTCGAGTATGGTACGACTATCAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004768.x-1297s1c1
Sequence:CCGGAGAACGATCAACAAGCAAGAACTCGAGTTCTTGCTTGTTGATCGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-432s21c1
Sequence:CCGGGAGCTTTGATAGTCGTACCATCTCGAGATGGTACGACTATCAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-222s21c1
Sequence:CCGGAGGTAATCCAGGTGACTAATGCTCGAGCATTAGTCACCTGGATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1562s21c1
Sequence:CCGGATGGATATGAGTGACTGAATACTCGAGTATTCAGTCACTCATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1703s21c1
Sequence:CCGGTAAAGCTCCTGTTACTCATATCTCGAGATATGAGTAACAGGAGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1501s21c1
Sequence:CCGGGGGAACTGGTGATTCACTAAGCTCGAGCTTAGTGAATCACCAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004768
VALIDATED
SRSF11 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004768.x-2400s1c1
Sequence:CCGGCCTTATCTCTTGCCCTTATTTCTCGAGAAATAAGGGCAAGAGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004768.x-814s1c1
Sequence:CCGGGTCCCTAATTTCTGCTGCTATCTCGAGATAGCAGCAGAAATTAGGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004768.x-432s1c1
Sequence:CCGGGAGCTTTGATAGTCGTACCATCTCGAGATGGTACGACTATCAAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004768.x-433s1c1
Sequence:CCGGAGCTTTGATAGTCGTACCATACTCGAGTATGGTACGACTATCAAAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004768.x-1297s1c1
Sequence:CCGGAGAACGATCAACAAGCAAGAACTCGAGTTCTTGCTTGTTGATCGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-432s21c1
Sequence:CCGGGAGCTTTGATAGTCGTACCATCTCGAGATGGTACGACTATCAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-222s21c1
Sequence:CCGGAGGTAATCCAGGTGACTAATGCTCGAGCATTAGTCACCTGGATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1562s21c1
Sequence:CCGGATGGATATGAGTGACTGAATACTCGAGTATTCAGTCACTCATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1703s21c1
Sequence:CCGGTAAAGCTCCTGTTACTCATATCTCGAGATATGAGTAACAGGAGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004768.2-1501s21c1
Sequence:CCGGGGGAACTGGTGATTCACTAAGCTCGAGCTTAGTGAATCACCAGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks