EMAIL THIS PAGE TO A FRIEND

SRSF12

serine/arginine-rich splicing factor 12

Synonyms: RP11-63L7.3 SFRS13B SFRS19 SRrp35
UniProtKB ID: Q8WXF0, B2RA22, Q5T7K0, Q8WW25
Gene ID:
Mouse(272009) serine/arginine-rich splicing factor 12
Rat(297962) serine/arginine-rich splicing factor 12
domestic guinea pig(100728692) serine/arginine-rich splicing factor 12
naked mole-rat(101726461) serine/arginine-rich splicing factor 12
cow(787762) serine/arginine-rich splicing factor 12
sheep(101114618) serine/arginine-rich splicing factor 12
dog(474992) serine/arginine-rich splicing factor 12
domestic cat(101097645) serine/arginine-rich splicing factor 12
Horse(100070965) serine/arginine-rich splicing factor 12
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080743 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054131 MISSION® esiRNA esiRNA human RP11-63L7.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080743 Rosetta Predictions human pricing
XM_001057019 Rosetta Predictions rat pricing
XM_216364 Rosetta Predictions rat pricing
NM_177774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362535 predicted 901
2 SASI_Hs02_00362536 predicted 866
3 SASI_Hs01_00077750 predicted 598
4 SASI_Hs02_00362537 predicted 1067
5 SASI_Hs01_00077752 predicted 391
6 SASI_Hs02_00362538 predicted 640
7 SASI_Hs02_00362539 predicted 996
8 SASI_Hs02_00362540 predicted 909
9 SASI_Hs01_00077757 predicted 295
10 SASI_Hs02_00362541 predicted 542
11 SASI_Hs01_00077748 predicted 198
12 SASI_Hs01_00077749 predicted 323
13 SASI_Hs01_00077751 predicted 431
14 SASI_Hs01_00077753 predicted 607
15 SASI_Hs01_00077754 predicted 766
16 SASI_Hs01_00077755 predicted 319
17 SASI_Hs01_00077756 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285147 predicted 220
2 SASI_Rn02_00285148 predicted 425
3 SASI_Rn02_00285149 predicted 504
4 SASI_Rn02_00285150 predicted 397
5 SASI_Rn02_00285151 predicted 402
6 SASI_Rn02_00285152 predicted 220
7 SASI_Rn02_00285153 predicted 231
8 SASI_Rn02_00285154 predicted 232
9 SASI_Rn02_00285155 predicted 491
10 SASI_Rn02_00285156 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376540 predicted 216
2 SASI_Rn02_00376541 predicted 425
3 SASI_Rn02_00376542 predicted 507
4 SASI_Rn02_00376543 predicted 394
5 SASI_Rn02_00376544 predicted 402
6 SASI_Rn02_00376545 predicted 217
7 SASI_Rn02_00376546 predicted 226
8 SASI_Rn02_00376547 predicted 230
9 SASI_Rn02_00376548 predicted 493
10 SASI_Rn02_00376549 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187846 predicted 1330
2 SASI_Mm01_00187847 predicted 1088
3 SASI_Mm01_00187848 predicted 544
4 SASI_Mm01_00187849 predicted 1189
5 SASI_Mm01_00187851 predicted 1050
6 SASI_Mm02_00348170 predicted 534
7 SASI_Mm01_00187852 predicted 1205
8 SASI_Mm01_00187853 predicted 968
9 SASI_Mm02_00348171 predicted 551
10 SASI_Mm01_00187855 predicted 1266
11 SASI_Mm01_00187850 predicted 641
12 SASI_Mm01_00187854 predicted 1196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177774
SRSF12 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177774.4-1290s21c1
Sequence:CCGGGAATAGGCCAGAGACTTAAACCTCGAGGTTTAAGTCTCTGGCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177774.4-551s21c1
Sequence:CCGGCAGTCTAAATCTCGTTCCAAACTCGAGTTTGGAACGAGATTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177774.4-747s21c1
Sequence:CCGGGACGACACTGTGACTCCATAGCTCGAGCTATGGAGTCACAGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-1212s1c1
Sequence:CCGGGCCAATAATATCCTTTACCAACTCGAGTTGGTAAAGGATATTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-2450s1c1
Sequence:CCGGCCAAATAACTTTGTTGGCAATCTCGAGATTGCCAACAAAGTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-1029s1c1
Sequence:CCGGGCCCTAGCTTTGGTTAATAAACTCGAGTTTATTAACCAAAGCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177774.2-635s1c1
Sequence:CCGGCAGAGGACGATCAAGATCCAACTCGAGTTGGATCTTGATCGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177774
SRSF12 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177774.4-1290s21c1
Sequence:CCGGGAATAGGCCAGAGACTTAAACCTCGAGGTTTAAGTCTCTGGCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177774.4-551s21c1
Sequence:CCGGCAGTCTAAATCTCGTTCCAAACTCGAGTTTGGAACGAGATTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177774.4-747s21c1
Sequence:CCGGGACGACACTGTGACTCCATAGCTCGAGCTATGGAGTCACAGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-1212s1c1
Sequence:CCGGGCCAATAATATCCTTTACCAACTCGAGTTGGTAAAGGATATTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-2450s1c1
Sequence:CCGGCCAAATAACTTTGTTGGCAATCTCGAGATTGCCAACAAAGTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-1029s1c1
Sequence:CCGGGCCCTAGCTTTGGTTAATAAACTCGAGTTTATTAACCAAAGCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177774.2-635s1c1
Sequence:CCGGCAGAGGACGATCAAGATCCAACTCGAGTTGGATCTTGATCGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177774
SRSF12 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177774.4-1290s21c1
Sequence:CCGGGAATAGGCCAGAGACTTAAACCTCGAGGTTTAAGTCTCTGGCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177774.4-551s21c1
Sequence:CCGGCAGTCTAAATCTCGTTCCAAACTCGAGTTTGGAACGAGATTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177774.4-747s21c1
Sequence:CCGGGACGACACTGTGACTCCATAGCTCGAGCTATGGAGTCACAGTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-1212s1c1
Sequence:CCGGGCCAATAATATCCTTTACCAACTCGAGTTGGTAAAGGATATTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182899    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-2450s1c1
Sequence:CCGGCCAAATAACTTTGTTGGCAATCTCGAGATTGCCAACAAAGTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177774.2-1029s1c1
Sequence:CCGGGCCCTAGCTTTGGTTAATAAACTCGAGTTTATTAACCAAAGCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177774.2-635s1c1
Sequence:CCGGCAGAGGACGATCAAGATCCAACTCGAGTTGGATCTTGATCGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080743
SRSF12 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 12
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080743.4-1070s21c1
Sequence:CCGGATGCGAGTTGATATTAGTTACCTCGAGGTAACTAATATCAACTCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080743.4-1276s21c1
Sequence:CCGGATTCTACTTGCATAGTATTAGCTCGAGCTAATACTATGCAAGTAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080743.4-947s21c1
Sequence:CCGGATCTCGAAGTTATCGTCATAACTCGAGTTATGACGATAACTTCGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-715s1c1
Sequence:CCGGCACAGTCAAGTTCACCTCAAACTCGAGTTTGAGGTGAACTTGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-487s1c1
Sequence:CCGGGAACTCGAAGTAGAAGTTCTTCTCGAGAAGAACTTCTACTTCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-245s1c1
Sequence:CCGGCGTTTACATTCCACTTGACTTCTCGAGAAGTCAAGTGGAATGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-692s1c1
Sequence:CCGGGAGGTCCAAGTCAATAGGAAACTCGAGTTTCCTATTGACTTGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-475s1c1
Sequence:CCGGCCAGCCAAAGAAGAACTCGAACTCGAGTTCGAGTTCTTCTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-802s1c1
Sequence:CCGGCGTGTAAATCTCCCAAAGGGTCTCGAGACCCTTTGGGAGATTTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-306s1c1
Sequence:CCGGGAAGATGTTCGAGGTGCTGAACTCGAGTTCAGCACCTCGAACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-737s1c1
Sequence:CCGGGCAGACTAGCTCAGGAACAAACTCGAGTTTGTTCCTGAGCTAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080743
SRSF12 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 12
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080743.4-1070s21c1
Sequence:CCGGATGCGAGTTGATATTAGTTACCTCGAGGTAACTAATATCAACTCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080743.4-1276s21c1
Sequence:CCGGATTCTACTTGCATAGTATTAGCTCGAGCTAATACTATGCAAGTAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080743.4-947s21c1
Sequence:CCGGATCTCGAAGTTATCGTCATAACTCGAGTTATGACGATAACTTCGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-715s1c1
Sequence:CCGGCACAGTCAAGTTCACCTCAAACTCGAGTTTGAGGTGAACTTGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-487s1c1
Sequence:CCGGGAACTCGAAGTAGAAGTTCTTCTCGAGAAGAACTTCTACTTCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-245s1c1
Sequence:CCGGCGTTTACATTCCACTTGACTTCTCGAGAAGTCAAGTGGAATGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-692s1c1
Sequence:CCGGGAGGTCCAAGTCAATAGGAAACTCGAGTTTCCTATTGACTTGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-475s1c1
Sequence:CCGGCCAGCCAAAGAAGAACTCGAACTCGAGTTCGAGTTCTTCTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-802s1c1
Sequence:CCGGCGTGTAAATCTCCCAAAGGGTCTCGAGACCCTTTGGGAGATTTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-306s1c1
Sequence:CCGGGAAGATGTTCGAGGTGCTGAACTCGAGTTCAGCACCTCGAACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-737s1c1
Sequence:CCGGGCAGACTAGCTCAGGAACAAACTCGAGTTTGTTCCTGAGCTAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080743
SRSF12 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 12
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432032    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080743.4-1070s21c1
Sequence:CCGGATGCGAGTTGATATTAGTTACCTCGAGGTAACTAATATCAACTCGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080743.4-1276s21c1
Sequence:CCGGATTCTACTTGCATAGTATTAGCTCGAGCTAATACTATGCAAGTAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080743.4-947s21c1
Sequence:CCGGATCTCGAAGTTATCGTCATAACTCGAGTTATGACGATAACTTCGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-715s1c1
Sequence:CCGGCACAGTCAAGTTCACCTCAAACTCGAGTTTGAGGTGAACTTGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-487s1c1
Sequence:CCGGGAACTCGAAGTAGAAGTTCTTCTCGAGAAGAACTTCTACTTCGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-245s1c1
Sequence:CCGGCGTTTACATTCCACTTGACTTCTCGAGAAGTCAAGTGGAATGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-692s1c1
Sequence:CCGGGAGGTCCAAGTCAATAGGAAACTCGAGTTTCCTATTGACTTGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-475s1c1
Sequence:CCGGCCAGCCAAAGAAGAACTCGAACTCGAGTTCGAGTTCTTCTTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-802s1c1
Sequence:CCGGCGTGTAAATCTCCCAAAGGGTCTCGAGACCCTTTGGGAGATTTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080743.2-306s1c1
Sequence:CCGGGAAGATGTTCGAGGTGCTGAACTCGAGTTCAGCACCTCGAACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080743.2-737s1c1
Sequence:CCGGGCAGACTAGCTCAGGAACAAACTCGAGTTTGTTCCTGAGCTAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks