EMAIL THIS PAGE TO A FRIEND

SRSF1

serine/arginine-rich splicing factor 1

Synonyms: ASF SF2 SF2p33 SFRS1 SRp30a
UniProtKB ID: Q07955, B2R6Z7, D3DTZ3, Q13809
Gene ID:
Human(6426) Summary: This gene encodes a member of the arginine/serine-rich splicing factor protein family, and functions in both constitutive and alternative pre-mRNA splicing. The protein binds to pre-mRNA transcripts and components of the spliceosome, and can either activate or repress splicing depending on the location of the pre-mRNA binding site. The protein's ability to activate splicing is regulated by phosphorylation and interactions with other splicing factor associated proteins. Multiple transcript variants encoding different isoforms have been found for this gene. In addition, a pseudogene of this gene has been found on chromosome 13. [provided by RefSeq, Sep 2010]
Mouse(110809) serine/arginine-rich splicing factor 1
Rat(689890) serine/arginine-rich splicing factor 1
chicken(772264) serine/arginine-rich splicing factor 1
dog(609693) serine/arginine-rich splicing factor 1
domestic cat(101100012) serine/arginine-rich splicing factor 1
Horse(100056763) serine/arginine-rich splicing factor 1
cow(615796) serine/arginine-rich splicing factor 1
sheep(101121021) serine/arginine-rich splicing factor 1
naked mole-rat(101699866) serine/arginine-rich splicing factor 1
domestic guinea pig(100721786) serine/arginine-rich splicing factor 1
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006924 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078166 Rosetta Predictions human pricing
NM_006924 Rosetta Predictions human pricing
NM_001109552 Rosetta Predictions rat pricing
NM_001078167 Rosetta Predictions mouse pricing
NM_173374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313260 predicted 251
2 SASI_Hs02_00313261 predicted 432
3 SASI_Hs02_00313262 predicted 901
4 SASI_Hs02_00313263 predicted 742
5 SASI_Hs02_00313264 predicted 814
6 SASI_Hs02_00313265 predicted 912
7 SASI_Hs02_00313266 predicted 249
8 SASI_Hs02_00313267 predicted 899
9 SASI_Hs02_00313268 predicted 778
10 SASI_Hs02_00313269 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115059 predicted 997
2 SASI_Hs02_00342609 predicted 1431
3 SASI_Hs02_00342610 predicted 251
4 SASI_Hs02_00342611 predicted 1342
5 SASI_Hs01_00115062 predicted 431
6 SASI_Hs02_00342612 predicted 1394
7 SASI_Hs01_00115063 predicted 1150
8 SASI_Hs02_00342613 predicted 239
9 SASI_Hs02_00342614 predicted 1056
10 SASI_Hs01_00115064 predicted 418
11 SASI_Hs01_00115056 predicted 655
12 SASI_Hs01_00115057 predicted 945
13 SASI_Hs01_00115058 predicted 1081
14 SASI_Hs01_00115060 predicted 814
15 SASI_Hs01_00115061 predicted 952
16 SASI_Hs01_00115065 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249519 predicted 1523
2 SASI_Rn02_00249520 predicted 2198
3 SASI_Rn02_00249521 predicted 1383
4 SASI_Rn02_00249522 predicted 2102
5 SASI_Rn02_00249523 predicted 1073
6 SASI_Rn02_00249524 predicted 1482
7 SASI_Rn02_00249525 predicted 1325
8 SASI_Rn02_00249526 predicted 2162
9 SASI_Rn02_00249527 predicted 2074
10 SASI_Rn02_00249528 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292972 predicted 1149
2 SASI_Mm02_00292973 predicted 919
3 SASI_Mm02_00292974 predicted 700
4 SASI_Mm02_00292975 predicted 704
5 SASI_Mm02_00292976 predicted 870
6 SASI_Mm02_00292977 predicted 835
7 SASI_Mm02_00292978 predicted 681
8 SASI_Mm02_00292979 predicted 869
9 SASI_Mm02_00292980 predicted 851
10 SASI_Mm02_00292981 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148248 predicted 1283
2 SASI_Mm01_00148250 predicted 1120
3 SASI_Mm01_00148251 predicted 1319
4 SASI_Mm01_00148252 predicted 960
5 SASI_Mm02_00345183 predicted 1075
6 SASI_Mm01_00148253 predicted 1401
7 SASI_Mm02_00345184 predicted 1396
8 SASI_Mm02_00345185 predicted 933
9 SASI_Mm01_00148256 predicted 1308
10 SASI_Mm02_00345186 predicted 1153
11 SASI_Mm01_00148249 predicted 736
12 SASI_Mm01_00148254 predicted 689
13 SASI_Mm01_00148255 predicted 889
14 SASI_Mm01_00148257 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173374
VALIDATED
SRSF1 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-588s1c1
Sequence:CCGGCGGAAAGAAGATATGACGTATCTCGAGATACGTCATATCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-790s1c1
Sequence:CCGGGCAGAGGATCACCACGCTATTCTCGAGAATAGCGTGGTGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-647s1c1
Sequence:CCGGCGAGGGAGAAACTGCCTACATCTCGAGATGTAGGCAGTTTCTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-534s1c1
Sequence:CCGGGATGTATGTTACGCTGATGTTCTCGAGAACATCAGCGTAACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-658s21c1
Sequence:CCGGCGGAAAGAAGATATGACGTATCTCGAGATACGTCATATCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-604s21c1
Sequence:CCGGGATGTATGTTACGCTGATGTTCTCGAGAACATCAGCGTAACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-860s21c1
Sequence:CCGGGCAGAGGATCACCACGCTATTCTCGAGAATAGCGTGGTGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-1289s21c1
Sequence:CCGGTATCTGAAGAGATGGATTAAGCTCGAGCTTAATCCATCTCTTCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173374
VALIDATED
SRSF1 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-588s1c1
Sequence:CCGGCGGAAAGAAGATATGACGTATCTCGAGATACGTCATATCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-790s1c1
Sequence:CCGGGCAGAGGATCACCACGCTATTCTCGAGAATAGCGTGGTGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-647s1c1
Sequence:CCGGCGAGGGAGAAACTGCCTACATCTCGAGATGTAGGCAGTTTCTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-534s1c1
Sequence:CCGGGATGTATGTTACGCTGATGTTCTCGAGAACATCAGCGTAACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-658s21c1
Sequence:CCGGCGGAAAGAAGATATGACGTATCTCGAGATACGTCATATCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-604s21c1
Sequence:CCGGGATGTATGTTACGCTGATGTTCTCGAGAACATCAGCGTAACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-860s21c1
Sequence:CCGGGCAGAGGATCACCACGCTATTCTCGAGAATAGCGTGGTGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-1289s21c1
Sequence:CCGGTATCTGAAGAGATGGATTAAGCTCGAGCTTAATCCATCTCTTCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173374
VALIDATED
SRSF1 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-588s1c1
Sequence:CCGGCGGAAAGAAGATATGACGTATCTCGAGATACGTCATATCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-790s1c1
Sequence:CCGGGCAGAGGATCACCACGCTATTCTCGAGAATAGCGTGGTGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-647s1c1
Sequence:CCGGCGAGGGAGAAACTGCCTACATCTCGAGATGTAGGCAGTTTCTCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173374.2-534s1c1
Sequence:CCGGGATGTATGTTACGCTGATGTTCTCGAGAACATCAGCGTAACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-658s21c1
Sequence:CCGGCGGAAAGAAGATATGACGTATCTCGAGATACGTCATATCTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-604s21c1
Sequence:CCGGGATGTATGTTACGCTGATGTTCTCGAGAACATCAGCGTAACATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-860s21c1
Sequence:CCGGGCAGAGGATCACCACGCTATTCTCGAGAATAGCGTGGTGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173374.3-1289s21c1
Sequence:CCGGTATCTGAAGAGATGGATTAAGCTCGAGCTTAATCCATCTCTTCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006924
VALIDATED
SRSF1 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006924.x-689s1c1
Sequence:CCGGCAAGTTATGGAAGATCTCGATCTCGAGATCGAGATCTTCCATAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-1965s1c1
Sequence:CCGGGCAACCACGAAACCTGTAATACTCGAGTATTACAGGTTTCGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-649s1c1
Sequence:CCGGACTGCCTACATCCGGGTTAAACTCGAGTTTAACCCGGATGTAGGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-155s1c1
Sequence:CCGGACTTACCTCCAGACATCCGAACTCGAGTTCGGATGTCTGGAGGTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-517s1c1
Sequence:CCGGGAAGCAGGTGATGTATGTTATCTCGAGATAACATACATCACCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-274s21c1
Sequence:CCGGACTTACCTCCAGACATCCGAACTCGAGTTCGGATGTCTGGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006924.4-2084s21c1
Sequence:CCGGGCAACCACGAAACCTGTAATACTCGAGTATTACAGGTTTCGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-936s21c1
Sequence:CCGGAGATCTCGCTCTCGTACATAACTCGAGTTATGTACGAGAGCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-636s21c1
Sequence:CCGGGAAGCAGGTGATGTATGTTATCTCGAGATAACATACATCACCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-425s21c1
Sequence:CCGGTGGTCGCGACGGCTATGATTACTCGAGTAATCATAGCCGTCGCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006924
VALIDATED
SRSF1 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006924.x-689s1c1
Sequence:CCGGCAAGTTATGGAAGATCTCGATCTCGAGATCGAGATCTTCCATAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-1965s1c1
Sequence:CCGGGCAACCACGAAACCTGTAATACTCGAGTATTACAGGTTTCGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-649s1c1
Sequence:CCGGACTGCCTACATCCGGGTTAAACTCGAGTTTAACCCGGATGTAGGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-155s1c1
Sequence:CCGGACTTACCTCCAGACATCCGAACTCGAGTTCGGATGTCTGGAGGTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-517s1c1
Sequence:CCGGGAAGCAGGTGATGTATGTTATCTCGAGATAACATACATCACCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-274s21c1
Sequence:CCGGACTTACCTCCAGACATCCGAACTCGAGTTCGGATGTCTGGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006924.4-2084s21c1
Sequence:CCGGGCAACCACGAAACCTGTAATACTCGAGTATTACAGGTTTCGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-936s21c1
Sequence:CCGGAGATCTCGCTCTCGTACATAACTCGAGTTATGTACGAGAGCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-636s21c1
Sequence:CCGGGAAGCAGGTGATGTATGTTATCTCGAGATAACATACATCACCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-425s21c1
Sequence:CCGGTGGTCGCGACGGCTATGATTACTCGAGTAATCATAGCCGTCGCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006924
VALIDATED
SRSF1 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006924.x-689s1c1
Sequence:CCGGCAAGTTATGGAAGATCTCGATCTCGAGATCGAGATCTTCCATAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-1965s1c1
Sequence:CCGGGCAACCACGAAACCTGTAATACTCGAGTATTACAGGTTTCGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-649s1c1
Sequence:CCGGACTGCCTACATCCGGGTTAAACTCGAGTTTAACCCGGATGTAGGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-155s1c1
Sequence:CCGGACTTACCTCCAGACATCCGAACTCGAGTTCGGATGTCTGGAGGTAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006924.x-517s1c1
Sequence:CCGGGAAGCAGGTGATGTATGTTATCTCGAGATAACATACATCACCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-274s21c1
Sequence:CCGGACTTACCTCCAGACATCCGAACTCGAGTTCGGATGTCTGGAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006924.4-2084s21c1
Sequence:CCGGGCAACCACGAAACCTGTAATACTCGAGTATTACAGGTTTCGTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-936s21c1
Sequence:CCGGAGATCTCGCTCTCGTACATAACTCGAGTTATGTACGAGAGCGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-636s21c1
Sequence:CCGGGAAGCAGGTGATGTATGTTATCTCGAGATAACATACATCACCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006924.4-425s21c1
Sequence:CCGGTGGTCGCGACGGCTATGATTACTCGAGTAATCATAGCCGTCGCGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks