EMAIL THIS PAGE TO A FRIEND

SRSF2

serine/arginine-rich splicing factor 2

Synonyms: PR264 SC-35 SC35 SFRS2 SFRS2A SRp30b
UniProtKB ID: Q01130, B3KWD5
Gene ID:
Human(6427) Summary: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding the same protein and one non-coding transcript variant have been found for this gene. In addition, a pseudogene of this gene has been found on chromosome 11. [provided by RefSeq, Sep 2010]
Mouse(20382) serine/arginine-rich splicing factor 2
Rat(494445) serine/arginine-rich splicing factor 2
chicken(396195) serine/arginine-rich splicing factor 2
dog(612817) serine/arginine-rich splicing factor 2
cow(508312) serine/arginine-rich splicing factor 2
naked mole-rat(101721554) serine/arginine-rich splicing factor 2
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003016 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003016 Rosetta Predictions human pricing
NM_001009720 Rosetta Predictions rat pricing
NM_011358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081729 predicted 1293
2 SASI_Hs01_00081730 predicted 1266
3 SASI_Hs01_00081731 predicted 1206
4 SASI_Hs01_00081732 predicted 1012
5 SASI_Hs01_00081733 predicted 1289
6 SASI_Hs01_00081734 predicted 336
7 SASI_Hs01_00081735 predicted 961
8 SASI_Hs01_00081736 predicted 661
9 SASI_Hs01_00081737 predicted 870
10 SASI_Hs01_00081738 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117748 predicted 845
2 SASI_Rn01_00117751 predicted 590
3 SASI_Rn01_00117752 predicted 798
4 SASI_Rn01_00117753 predicted 924
5 SASI_Rn01_00117754 predicted 836
6 SASI_Rn01_00117755 predicted 901
7 SASI_Rn01_00117756 predicted 648
8 SASI_Rn02_00199787 predicted 621
9 SASI_Rn02_00199788 predicted 592
10 SASI_Rn02_00199789 predicted 877
11 SASI_Rn01_00117747 predicted 888
12 SASI_Rn01_00117749 predicted 209
13 SASI_Rn01_00117750 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178855 predicted 837
2 SASI_Mm01_00178856 predicted 1044
3 SASI_Mm01_00178857 predicted 1062
4 SASI_Mm01_00178858 predicted 1013
5 SASI_Mm01_00178859 predicted 939
6 SASI_Mm01_00178861 predicted 1045
7 SASI_Mm01_00178862 predicted 571
8 SASI_Mm01_00178863 predicted 799
9 SASI_Mm01_00178864 predicted 823
10 SASI_Mm02_00320512 predicted 322
11 SASI_Mm01_00178860 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011358
VALIDATED
SRSF2 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-234s1c1
Sequence:CCGGCGACACCCTGAGGCGCGTCTTCTCGAGAAGACGCGCCTCAGGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-740s1c1
Sequence:CCGGCGAAGCGAGAGTCCAAGTCTACTCGAGTAGACTTGGACTCTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-268s1c1
Sequence:CCGGCGCGTCGGCGACGTGTACATTCTCGAGAATGTACACGTCGCCGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-635s1c1
Sequence:CCGGCCAAGTCCAGATCTGCCCGAACTCGAGTTCGGGCAGATCTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-751s21c1
Sequence:CCGGTCGAAGCGAGAGTCCAAGTCTCTCGAGAGACTTGGACTCTCGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-804s21c1
Sequence:CCGGAGAAGAAGAGGGAGCAGTTTCCTCGAGGAAACTGCTCCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-650s21c1
Sequence:CCGGAGTCCAGATCTGCCCGAAGATCTCGAGATCTTCGGGCAGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011358.2-255s21c1
Sequence:CCGGGAGGCGCGTCTTCGAGAAATACTCGAGTATTTCTCGAAGACGCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-1307s21c1
Sequence:CCGGATTTACCTTCAGGTCTATATGCTCGAGCATATAGACCTGAAGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011358
VALIDATED
SRSF2 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-234s1c1
Sequence:CCGGCGACACCCTGAGGCGCGTCTTCTCGAGAAGACGCGCCTCAGGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-740s1c1
Sequence:CCGGCGAAGCGAGAGTCCAAGTCTACTCGAGTAGACTTGGACTCTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-268s1c1
Sequence:CCGGCGCGTCGGCGACGTGTACATTCTCGAGAATGTACACGTCGCCGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-635s1c1
Sequence:CCGGCCAAGTCCAGATCTGCCCGAACTCGAGTTCGGGCAGATCTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-751s21c1
Sequence:CCGGTCGAAGCGAGAGTCCAAGTCTCTCGAGAGACTTGGACTCTCGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-804s21c1
Sequence:CCGGAGAAGAAGAGGGAGCAGTTTCCTCGAGGAAACTGCTCCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-650s21c1
Sequence:CCGGAGTCCAGATCTGCCCGAAGATCTCGAGATCTTCGGGCAGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011358.2-255s21c1
Sequence:CCGGGAGGCGCGTCTTCGAGAAATACTCGAGTATTTCTCGAAGACGCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-1307s21c1
Sequence:CCGGATTTACCTTCAGGTCTATATGCTCGAGCATATAGACCTGAAGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011358
VALIDATED
SRSF2 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-234s1c1
Sequence:CCGGCGACACCCTGAGGCGCGTCTTCTCGAGAAGACGCGCCTCAGGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-740s1c1
Sequence:CCGGCGAAGCGAGAGTCCAAGTCTACTCGAGTAGACTTGGACTCTCGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-268s1c1
Sequence:CCGGCGCGTCGGCGACGTGTACATTCTCGAGAATGTACACGTCGCCGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011358.1-635s1c1
Sequence:CCGGCCAAGTCCAGATCTGCCCGAACTCGAGTTCGGGCAGATCTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-751s21c1
Sequence:CCGGTCGAAGCGAGAGTCCAAGTCTCTCGAGAGACTTGGACTCTCGCTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-804s21c1
Sequence:CCGGAGAAGAAGAGGGAGCAGTTTCCTCGAGGAAACTGCTCCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-650s21c1
Sequence:CCGGAGTCCAGATCTGCCCGAAGATCTCGAGATCTTCGGGCAGATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011358.2-255s21c1
Sequence:CCGGGAGGCGCGTCTTCGAGAAATACTCGAGTATTTCTCGAAGACGCGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011358.2-1307s21c1
Sequence:CCGGATTTACCTTCAGGTCTATATGCTCGAGCATATAGACCTGAAGGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003016
VALIDATED
SRSF2 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 2
Human
32 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1421s1c1
Sequence:CCGGTAGGCGCAGTTGTGTAGCAGTCTCGAGACTGCTACACAACTGCGCCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1423s1c1
Sequence:CCGGGGCGCAGTTGTGTAGCAGTTGCTCGAGCAACTGCTACACAACTGCGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-829s1c1
Sequence:CCGGATGTATCGGCAAGCAGTGTAACTCGAGTTACACTGCTTGCCGATACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1539s1c1
Sequence:CCGGGTCGTGCAGAAACAAATGGCTCTCGAGAGCCATTTGTTTCTGCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-1508s1c1
Sequence:CCGGTCTCCCGATTGCTCCTGTGTACTCGAGTACACAGGAGCAATCGGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1427s1c1
Sequence:CCGGCAGTTGTGTAGCAGTTGAGTACTCGAGTACTCAACTGCTACACAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-831s1c1
Sequence:CCGGGTATCGGCAAGCAGTGTAAACCTCGAGGTTTACACTGCTTGCCGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-834s1c1
Sequence:CCGGTCGGCAAGCAGTGTAAACGGACTCGAGTCCGTTTACACTGCTTGCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-875s1c1
Sequence:CCGGACATAGTCCATCGAAGAAGAGCTCGAGCTCTTCTTCGATGGACTATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1512s1c1
Sequence:CCGGCCGATTGCTCCTGTGTAAAGACTCGAGTCTTTACACAGGAGCAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1603s1c1
Sequence:CCGGCGGGCCTTGCATATAAATAACCTCGAGGTTATTTATATGCAAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-876s1c1
Sequence:CCGGCATAGTCCATCGAAGAAGAGTCTCGAGACTCTTCTTCGATGGACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-874s1c1
Sequence:CCGGCACATAGTCCATCGAAGAAGACTCGAGTCTTCTTCGATGGACTATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1422s1c1
Sequence:CCGGAGGCGCAGTTGTGTAGCAGTTCTCGAGAACTGCTACACAACTGCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-879s1c1
Sequence:CCGGAGTCCATCGAAGAAGAGTCCTCTCGAGAGGACTCTTCTTCGATGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-872s1c1
Sequence:CCGGACCACATAGTCCATCGAAGAACTCGAGTTCTTCGATGGACTATGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1428s1c1
Sequence:CCGGAGTTGTGTAGCAGTTGAGTAACTCGAGTTACTCAACTGCTACACAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1066s1c1
Sequence:CCGGTGGATTTGGATATTTGAGGTACTCGAGTACCTCAAATATCCAAATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1513s1c1
Sequence:CCGGCGATTGCTCCTGTGTAAAGATCTCGAGATCTTTACACAGGAGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-832s1c1
Sequence:CCGGTATCGGCAAGCAGTGTAAACGCTCGAGCGTTTACACTGCTTGCCGATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1515s1c1
Sequence:CCGGATTGCTCCTGTGTAAAGATGCCTCGAGGCATCTTTACACAGGAGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1516s1c1
Sequence:CCGGTTGCTCCTGTGTAAAGATGCCCTCGAGGGCATCTTTACACAGGAGCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-836s1c1
Sequence:CCGGGGCAAGCAGTGTAAACGGAGGCTCGAGCCTCCGTTTACACTGCTTGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-833s1c1
Sequence:CCGGATCGGCAAGCAGTGTAAACGGCTCGAGCCGTTTACACTGCTTGCCGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1506s1c1
Sequence:CCGGTTTCTCCCGATTGCTCCTGTGCTCGAGCACAGGAGCAATCGGGAGAAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1514s1c1
Sequence:CCGGGATTGCTCCTGTGTAAAGATGCTCGAGCATCTTTACACAGGAGCAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1511s1c1
Sequence:CCGGCCCGATTGCTCCTGTGTAAAGCTCGAGCTTTACACAGGAGCAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-877s1c1
Sequence:CCGGATAGTCCATCGAAGAAGAGTCCTCGAGGACTCTTCTTCGATGGACTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-878s1c1
Sequence:CCGGTAGTCCATCGAAGAAGAGTCCCTCGAGGGACTCTTCTTCGATGGACTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-873s1c1
Sequence:CCGGCCACATAGTCCATCGAAGAAGCTCGAGCTTCTTCGATGGACTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1485s1c1
Sequence:CCGGGAGTGCTTGGCTGTTTCCTGTCTCGAGACAGGAAACAGCCAAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-835s1c1
Sequence:CCGGCGGCAAGCAGTGTAAACGGAGCTCGAGCTCCGTTTACACTGCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003016
VALIDATED
SRSF2 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 2
Human
32 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1421s1c1
Sequence:CCGGTAGGCGCAGTTGTGTAGCAGTCTCGAGACTGCTACACAACTGCGCCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1423s1c1
Sequence:CCGGGGCGCAGTTGTGTAGCAGTTGCTCGAGCAACTGCTACACAACTGCGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-829s1c1
Sequence:CCGGATGTATCGGCAAGCAGTGTAACTCGAGTTACACTGCTTGCCGATACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1539s1c1
Sequence:CCGGGTCGTGCAGAAACAAATGGCTCTCGAGAGCCATTTGTTTCTGCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-1508s1c1
Sequence:CCGGTCTCCCGATTGCTCCTGTGTACTCGAGTACACAGGAGCAATCGGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1427s1c1
Sequence:CCGGCAGTTGTGTAGCAGTTGAGTACTCGAGTACTCAACTGCTACACAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-831s1c1
Sequence:CCGGGTATCGGCAAGCAGTGTAAACCTCGAGGTTTACACTGCTTGCCGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-834s1c1
Sequence:CCGGTCGGCAAGCAGTGTAAACGGACTCGAGTCCGTTTACACTGCTTGCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-875s1c1
Sequence:CCGGACATAGTCCATCGAAGAAGAGCTCGAGCTCTTCTTCGATGGACTATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1512s1c1
Sequence:CCGGCCGATTGCTCCTGTGTAAAGACTCGAGTCTTTACACAGGAGCAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1603s1c1
Sequence:CCGGCGGGCCTTGCATATAAATAACCTCGAGGTTATTTATATGCAAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-876s1c1
Sequence:CCGGCATAGTCCATCGAAGAAGAGTCTCGAGACTCTTCTTCGATGGACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-874s1c1
Sequence:CCGGCACATAGTCCATCGAAGAAGACTCGAGTCTTCTTCGATGGACTATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1422s1c1
Sequence:CCGGAGGCGCAGTTGTGTAGCAGTTCTCGAGAACTGCTACACAACTGCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-879s1c1
Sequence:CCGGAGTCCATCGAAGAAGAGTCCTCTCGAGAGGACTCTTCTTCGATGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-872s1c1
Sequence:CCGGACCACATAGTCCATCGAAGAACTCGAGTTCTTCGATGGACTATGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1428s1c1
Sequence:CCGGAGTTGTGTAGCAGTTGAGTAACTCGAGTTACTCAACTGCTACACAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1066s1c1
Sequence:CCGGTGGATTTGGATATTTGAGGTACTCGAGTACCTCAAATATCCAAATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1513s1c1
Sequence:CCGGCGATTGCTCCTGTGTAAAGATCTCGAGATCTTTACACAGGAGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-832s1c1
Sequence:CCGGTATCGGCAAGCAGTGTAAACGCTCGAGCGTTTACACTGCTTGCCGATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1515s1c1
Sequence:CCGGATTGCTCCTGTGTAAAGATGCCTCGAGGCATCTTTACACAGGAGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1516s1c1
Sequence:CCGGTTGCTCCTGTGTAAAGATGCCCTCGAGGGCATCTTTACACAGGAGCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-836s1c1
Sequence:CCGGGGCAAGCAGTGTAAACGGAGGCTCGAGCCTCCGTTTACACTGCTTGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-833s1c1
Sequence:CCGGATCGGCAAGCAGTGTAAACGGCTCGAGCCGTTTACACTGCTTGCCGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1506s1c1
Sequence:CCGGTTTCTCCCGATTGCTCCTGTGCTCGAGCACAGGAGCAATCGGGAGAAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1514s1c1
Sequence:CCGGGATTGCTCCTGTGTAAAGATGCTCGAGCATCTTTACACAGGAGCAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1511s1c1
Sequence:CCGGCCCGATTGCTCCTGTGTAAAGCTCGAGCTTTACACAGGAGCAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-877s1c1
Sequence:CCGGATAGTCCATCGAAGAAGAGTCCTCGAGGACTCTTCTTCGATGGACTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-878s1c1
Sequence:CCGGTAGTCCATCGAAGAAGAGTCCCTCGAGGGACTCTTCTTCGATGGACTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-873s1c1
Sequence:CCGGCCACATAGTCCATCGAAGAAGCTCGAGCTTCTTCGATGGACTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1485s1c1
Sequence:CCGGGAGTGCTTGGCTGTTTCCTGTCTCGAGACAGGAAACAGCCAAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-835s1c1
Sequence:CCGGCGGCAAGCAGTGTAAACGGAGCTCGAGCTCCGTTTACACTGCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003016
VALIDATED
SRSF2 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 2
Human
32 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1421s1c1
Sequence:CCGGTAGGCGCAGTTGTGTAGCAGTCTCGAGACTGCTACACAACTGCGCCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1423s1c1
Sequence:CCGGGGCGCAGTTGTGTAGCAGTTGCTCGAGCAACTGCTACACAACTGCGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-829s1c1
Sequence:CCGGATGTATCGGCAAGCAGTGTAACTCGAGTTACACTGCTTGCCGATACATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1539s1c1
Sequence:CCGGGTCGTGCAGAAACAAATGGCTCTCGAGAGCCATTTGTTTCTGCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-1508s1c1
Sequence:CCGGTCTCCCGATTGCTCCTGTGTACTCGAGTACACAGGAGCAATCGGGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1427s1c1
Sequence:CCGGCAGTTGTGTAGCAGTTGAGTACTCGAGTACTCAACTGCTACACAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-831s1c1
Sequence:CCGGGTATCGGCAAGCAGTGTAAACCTCGAGGTTTACACTGCTTGCCGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-834s1c1
Sequence:CCGGTCGGCAAGCAGTGTAAACGGACTCGAGTCCGTTTACACTGCTTGCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-875s1c1
Sequence:CCGGACATAGTCCATCGAAGAAGAGCTCGAGCTCTTCTTCGATGGACTATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1512s1c1
Sequence:CCGGCCGATTGCTCCTGTGTAAAGACTCGAGTCTTTACACAGGAGCAATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1603s1c1
Sequence:CCGGCGGGCCTTGCATATAAATAACCTCGAGGTTATTTATATGCAAGGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-876s1c1
Sequence:CCGGCATAGTCCATCGAAGAAGAGTCTCGAGACTCTTCTTCGATGGACTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-874s1c1
Sequence:CCGGCACATAGTCCATCGAAGAAGACTCGAGTCTTCTTCGATGGACTATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1422s1c1
Sequence:CCGGAGGCGCAGTTGTGTAGCAGTTCTCGAGAACTGCTACACAACTGCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-879s1c1
Sequence:CCGGAGTCCATCGAAGAAGAGTCCTCTCGAGAGGACTCTTCTTCGATGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-872s1c1
Sequence:CCGGACCACATAGTCCATCGAAGAACTCGAGTTCTTCGATGGACTATGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1428s1c1
Sequence:CCGGAGTTGTGTAGCAGTTGAGTAACTCGAGTTACTCAACTGCTACACAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1066s1c1
Sequence:CCGGTGGATTTGGATATTTGAGGTACTCGAGTACCTCAAATATCCAAATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1513s1c1
Sequence:CCGGCGATTGCTCCTGTGTAAAGATCTCGAGATCTTTACACAGGAGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-832s1c1
Sequence:CCGGTATCGGCAAGCAGTGTAAACGCTCGAGCGTTTACACTGCTTGCCGATATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1515s1c1
Sequence:CCGGATTGCTCCTGTGTAAAGATGCCTCGAGGCATCTTTACACAGGAGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1516s1c1
Sequence:CCGGTTGCTCCTGTGTAAAGATGCCCTCGAGGGCATCTTTACACAGGAGCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000106    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003016.x-836s1c1
Sequence:CCGGGGCAAGCAGTGTAAACGGAGGCTCGAGCCTCCGTTTACACTGCTTGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-833s1c1
Sequence:CCGGATCGGCAAGCAGTGTAAACGGCTCGAGCCGTTTACACTGCTTGCCGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1506s1c1
Sequence:CCGGTTTCTCCCGATTGCTCCTGTGCTCGAGCACAGGAGCAATCGGGAGAAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1514s1c1
Sequence:CCGGGATTGCTCCTGTGTAAAGATGCTCGAGCATCTTTACACAGGAGCAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1511s1c1
Sequence:CCGGCCCGATTGCTCCTGTGTAAAGCTCGAGCTTTACACAGGAGCAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-877s1c1
Sequence:CCGGATAGTCCATCGAAGAAGAGTCCTCGAGGACTCTTCTTCGATGGACTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-878s1c1
Sequence:CCGGTAGTCCATCGAAGAAGAGTCCCTCGAGGGACTCTTCTTCGATGGACTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-873s1c1
Sequence:CCGGCCACATAGTCCATCGAAGAAGCTCGAGCTTCTTCGATGGACTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-1485s1c1
Sequence:CCGGGAGTGCTTGGCTGTTTCCTGTCTCGAGACAGGAAACAGCCAAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003016.x-835s1c1
Sequence:CCGGCGGCAAGCAGTGTAAACGGAGCTCGAGCTCCGTTTACACTGCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks