EMAIL THIS PAGE TO A FRIEND

SRSF3

serine/arginine-rich splicing factor 3

Synonyms: SFRS3 SRp20
UniProtKB ID: P84103, O08831, P23152, Q5R3K0
Gene ID:
Human(6428) Summary: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other non-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(20383) serine/arginine-rich splicing factor 3
Rat(361814) serine/arginine-rich splicing factor 3
chicken(419815) serine/arginine-rich splicing factor 3
dog(403687) serine/arginine-rich splicing factor 3
domestic cat(101081223) serine/arginine-rich splicing factor 3
domestic guinea pig(100720165) serine/arginine-rich splicing factor 3
naked mole-rat(101711396) serine/arginine-rich splicing factor 3
cow(540276) serine/arginine-rich splicing factor 3
sheep(100135442) serine/arginine-rich splicing factor 3
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003017 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003017 Rosetta Predictions human pricing
NM_001047907 Rosetta Predictions rat pricing
NM_013663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018995 predicted 194
2 SASI_Hs01_00018992 predicted 598
3 SASI_Hs01_00018993 predicted 326
4 SASI_Hs01_00018994 predicted 267
5 SASI_Hs01_00018996 predicted 562
6 SASI_Hs02_00334912 predicted 478
7 SASI_Hs01_00018997 predicted 617
8 SASI_Hs01_00018998 predicted 553
9 SASI_Hs01_00018999 predicted 632
10 SASI_Hs01_00019000 predicted 605
11 SASI_Hs01_00019001 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206685 predicted 831
2 SASI_Rn02_00206686 predicted 758
3 SASI_Rn02_00206687 predicted 825
4 SASI_Rn02_00206688 predicted 758
5 SASI_Rn02_00206689 predicted 758
6 SASI_Rn02_00206690 predicted 790
7 SASI_Rn02_00206691 predicted 583
8 SASI_Rn02_00206692 predicted 645
9 SASI_Rn02_00206693 predicted 619
10 SASI_Rn02_00206694 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067879 predicted 843
2 SASI_Mm01_00067880 predicted 762
3 SASI_Mm02_00322495 predicted 842
4 SASI_Mm01_00067873 predicted 658
5 SASI_Mm01_00067881 predicted 807
6 SASI_Mm01_00067875 predicted 899
7 SASI_Mm02_00322496 predicted 847
8 SASI_Mm02_00322497 predicted 638
9 SASI_Mm02_00322498 predicted 813
10 SASI_Mm02_00322499 predicted 595
11 SASI_Mm01_00067874 predicted 661
12 SASI_Mm01_00067876 predicted 650
13 SASI_Mm01_00067877 predicted 799
14 SASI_Mm01_00067878 predicted 800
15 SASI_Mm01_00067882 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013663
SRSF3 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-343s21c1
Sequence:CCGGTAAGAGTGGAACTGTCGAATGCTCGAGCATTCGACAGTTCCACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013663.4-801s21c1
Sequence:CCGGATCATAAGAGGCACGTGATATCTCGAGATATCACGTGCCTCTTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-145s21c1
Sequence:CCGGGTAAGGTTTATGTAGGTAATCCTCGAGGATTACCTACATAAACCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-175s21c1
Sequence:CCGGATGGAAACAAGACTGAATTAGCTCGAGCTAATTCAGTCTTGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-603s21c1
Sequence:CCGGAGGAAATAGAAGACCAGTTTGCTCGAGCAAACTGGTCTTCTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013663.4-1013s21c1
Sequence:CCGGGGAATGATAAAGCGGTGTTTACTCGAGTAAACACCGCTTTATCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-494s21c1
Sequence:CCGGCAGGTCACTTTCTAGAGATAGCTCGAGCTATCTCTAGAAAGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013663.3-956s1c1
Sequence:CCGGGCGGAAATTGAAAGAAGCTATCTCGAGATAGCTTCTTTCAATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-584s1c1
Sequence:CCGGGCCGATCTAGGTCAAATGAAACTCGAGTTTCATTTGACCTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-209s1c1
Sequence:CCGGGCTATTATGGACCACTCAGAACTCGAGTTCTGAGTGGTCCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-580s1c1
Sequence:CCGGCGTAGCCGATCTAGGTCAAATCTCGAGATTTGACCTAGATCGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-186s1c1
Sequence:CCGGGACTGAATTAGAACGGGCTTTCTCGAGAAAGCCCGTTCTAATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013663
SRSF3 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-343s21c1
Sequence:CCGGTAAGAGTGGAACTGTCGAATGCTCGAGCATTCGACAGTTCCACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013663.4-801s21c1
Sequence:CCGGATCATAAGAGGCACGTGATATCTCGAGATATCACGTGCCTCTTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-145s21c1
Sequence:CCGGGTAAGGTTTATGTAGGTAATCCTCGAGGATTACCTACATAAACCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-175s21c1
Sequence:CCGGATGGAAACAAGACTGAATTAGCTCGAGCTAATTCAGTCTTGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-603s21c1
Sequence:CCGGAGGAAATAGAAGACCAGTTTGCTCGAGCAAACTGGTCTTCTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013663.4-1013s21c1
Sequence:CCGGGGAATGATAAAGCGGTGTTTACTCGAGTAAACACCGCTTTATCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-494s21c1
Sequence:CCGGCAGGTCACTTTCTAGAGATAGCTCGAGCTATCTCTAGAAAGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013663.3-956s1c1
Sequence:CCGGGCGGAAATTGAAAGAAGCTATCTCGAGATAGCTTCTTTCAATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-584s1c1
Sequence:CCGGGCCGATCTAGGTCAAATGAAACTCGAGTTTCATTTGACCTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-209s1c1
Sequence:CCGGGCTATTATGGACCACTCAGAACTCGAGTTCTGAGTGGTCCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-580s1c1
Sequence:CCGGCGTAGCCGATCTAGGTCAAATCTCGAGATTTGACCTAGATCGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-186s1c1
Sequence:CCGGGACTGAATTAGAACGGGCTTTCTCGAGAAAGCCCGTTCTAATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013663
SRSF3 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-343s21c1
Sequence:CCGGTAAGAGTGGAACTGTCGAATGCTCGAGCATTCGACAGTTCCACTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013663.4-801s21c1
Sequence:CCGGATCATAAGAGGCACGTGATATCTCGAGATATCACGTGCCTCTTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-145s21c1
Sequence:CCGGGTAAGGTTTATGTAGGTAATCCTCGAGGATTACCTACATAAACCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-175s21c1
Sequence:CCGGATGGAAACAAGACTGAATTAGCTCGAGCTAATTCAGTCTTGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-603s21c1
Sequence:CCGGAGGAAATAGAAGACCAGTTTGCTCGAGCAAACTGGTCTTCTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013663.4-1013s21c1
Sequence:CCGGGGAATGATAAAGCGGTGTTTACTCGAGTAAACACCGCTTTATCATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013663.4-494s21c1
Sequence:CCGGCAGGTCACTTTCTAGAGATAGCTCGAGCTATCTCTAGAAAGTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013663.3-956s1c1
Sequence:CCGGGCGGAAATTGAAAGAAGCTATCTCGAGATAGCTTCTTTCAATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-584s1c1
Sequence:CCGGGCCGATCTAGGTCAAATGAAACTCGAGTTTCATTTGACCTAGATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-209s1c1
Sequence:CCGGGCTATTATGGACCACTCAGAACTCGAGTTCTGAGTGGTCCATAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-580s1c1
Sequence:CCGGCGTAGCCGATCTAGGTCAAATCTCGAGATTTGACCTAGATCGGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013663.3-186s1c1
Sequence:CCGGGACTGAATTAGAACGGGCTTTCTCGAGAAAGCCCGTTCTAATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003017
VALIDATED
SRSF3 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-813s21c1
Sequence:CCGGCAGTGACACAAAGGTGTAATTCTCGAGAATTACACCTTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003017.4-200s21c1
Sequence:CCGGGTAAGGTTTATGTAGGCAATCCTCGAGGATTGCCTACATAAACCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-361s21c1
Sequence:CCGGCGAGAGCTAGATGGAAGAACACTCGAGTGTTCTTCCATCTAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-549s21c1
Sequence:CCGGCAGGTCCCTTTCTAGAGATAGCTCGAGCTATCTCTAGAAAGGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-404s21c1
Sequence:CCGGTGGAACTGTCGAATGGTGAAACTCGAGTTTCACCATTCGACAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003017.x-1538s1c1
Sequence:CCGGCACTGTTACCATTGTTCTTATCTCGAGATAAGAACAATGGTAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003017.x-151s1c1
Sequence:CCGGACAATGGCAACAAGACGGAATCTCGAGATTCCGTCTTGTTGCCATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003017.x-285s1c1
Sequence:CCGGCGAGAGCTAGATGGAAGAACACTCGAGTGTTCTTCCATCTAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003017.x-328s1c1
Sequence:CCGGTGGAACTGTCGAATGGTGAAACTCGAGTTTCACCATTCGACAGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003017.x-164s1c1
Sequence:CCGGGACGGAATTGGAACGGGCTTTCTCGAGAAAGCCCGTTCCAATTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003017
VALIDATED
SRSF3 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-813s21c1
Sequence:CCGGCAGTGACACAAAGGTGTAATTCTCGAGAATTACACCTTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003017.4-200s21c1
Sequence:CCGGGTAAGGTTTATGTAGGCAATCCTCGAGGATTGCCTACATAAACCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-361s21c1
Sequence:CCGGCGAGAGCTAGATGGAAGAACACTCGAGTGTTCTTCCATCTAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-549s21c1
Sequence:CCGGCAGGTCCCTTTCTAGAGATAGCTCGAGCTATCTCTAGAAAGGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-404s21c1
Sequence:CCGGTGGAACTGTCGAATGGTGAAACTCGAGTTTCACCATTCGACAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003017.x-1538s1c1
Sequence:CCGGCACTGTTACCATTGTTCTTATCTCGAGATAAGAACAATGGTAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003017.x-151s1c1
Sequence:CCGGACAATGGCAACAAGACGGAATCTCGAGATTCCGTCTTGTTGCCATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003017.x-285s1c1
Sequence:CCGGCGAGAGCTAGATGGAAGAACACTCGAGTGTTCTTCCATCTAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003017.x-328s1c1
Sequence:CCGGTGGAACTGTCGAATGGTGAAACTCGAGTTTCACCATTCGACAGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003017.x-164s1c1
Sequence:CCGGGACGGAATTGGAACGGGCTTTCTCGAGAAAGCCCGTTCCAATTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003017
VALIDATED
SRSF3 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273174    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-813s21c1
Sequence:CCGGCAGTGACACAAAGGTGTAATTCTCGAGAATTACACCTTTGTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003017.4-200s21c1
Sequence:CCGGGTAAGGTTTATGTAGGCAATCCTCGAGGATTGCCTACATAAACCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-361s21c1
Sequence:CCGGCGAGAGCTAGATGGAAGAACACTCGAGTGTTCTTCCATCTAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-549s21c1
Sequence:CCGGCAGGTCCCTTTCTAGAGATAGCTCGAGCTATCTCTAGAAAGGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003017.4-404s21c1
Sequence:CCGGTGGAACTGTCGAATGGTGAAACTCGAGTTTCACCATTCGACAGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003017.x-1538s1c1
Sequence:CCGGCACTGTTACCATTGTTCTTATCTCGAGATAAGAACAATGGTAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003017.x-151s1c1
Sequence:CCGGACAATGGCAACAAGACGGAATCTCGAGATTCCGTCTTGTTGCCATTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003017.x-285s1c1
Sequence:CCGGCGAGAGCTAGATGGAAGAACACTCGAGTGTTCTTCCATCTAGCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003017.x-328s1c1
Sequence:CCGGTGGAACTGTCGAATGGTGAAACTCGAGTTTCACCATTCGACAGTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003017.x-164s1c1
Sequence:CCGGGACGGAATTGGAACGGGCTTTCTCGAGAAAGCCCGTTCCAATTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks