EMAIL THIS PAGE TO A FRIEND

SRSF4

serine/arginine-rich splicing factor 4

Synonyms: SFRS4 SRP75
UniProtKB ID: Q08170, Q5VXP1, Q9BUA4, Q9UEB5
Gene ID:
Human(6429) Summary: This gene encodes a member of the arginine/serine-rich splicing factor family. The encoded protein likely functions in mRNA processing. [provided by RefSeq, Feb 2009]
Mouse(57317) serine/arginine-rich splicing factor 4
Rat(362612) serine/arginine-rich splicing factor 4
domestic guinea pig(100715987) serine/arginine-rich splicing factor 4
naked mole-rat(101723832) serine/arginine-rich splicing factor 4
cow(614310) serine/arginine-rich splicing factor 4
Zebrafish(321872) serine/arginine-rich splicing factor 4
Horse(100070608) serine/arginine-rich splicing factor 4
domestic cat(101089628) serine/arginine-rich splicing factor 4
dog(478160) serine/arginine-rich splicing factor 4
chicken(419600) serine/arginine-rich splicing factor 4
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005626 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005626 Rosetta Predictions human pricing
NM_001108685 Rosetta Predictions rat pricing
NM_020587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065340 predicted 728
2 SASI_Hs01_00065341 predicted 357
3 SASI_Hs01_00065342 predicted 1425
4 SASI_Hs01_00065343 predicted 1642
5 SASI_Hs01_00065344 predicted 403
6 SASI_Hs01_00065345 predicted 1715
7 SASI_Hs01_00065346 predicted 1599
8 SASI_Hs01_00065347 predicted 1865
9 SASI_Hs01_00065348 predicted 1685
10 SASI_Hs01_00065349 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241065 predicted 722
2 SASI_Rn02_00241066 predicted 344
3 SASI_Rn02_00241067 predicted 1766
4 SASI_Rn02_00241068 predicted 530
5 SASI_Rn02_00241069 predicted 404
6 SASI_Rn02_00241070 predicted 1877
7 SASI_Rn02_00241071 predicted 418
8 SASI_Rn02_00241072 predicted 1585
9 SASI_Rn02_00241073 predicted 1846
10 SASI_Rn02_00241074 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325673 predicted 542
2 SASI_Mm02_00325674 predicted 1451
3 SASI_Mm02_00325675 predicted 1592
4 SASI_Mm02_00325676 predicted 1610
5 SASI_Mm02_00325677 predicted 559
6 SASI_Mm02_00325678 predicted 1369
7 SASI_Mm01_00180595 predicted 1686
8 SASI_Mm02_00325679 predicted 608
9 SASI_Mm01_00180596 predicted 1341
10 SASI_Mm01_00180598 predicted 1697
11 SASI_Mm01_00180594 predicted 795
12 SASI_Mm01_00180597 predicted 1095
13 SASI_Mm01_00180599 predicted 1116
14 SASI_Mm01_00180600 predicted 1026
15 SASI_Mm01_00180601 predicted 1351
16 SASI_Mm01_00180602 predicted 909
17 SASI_Mm01_00180603 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020587
VALIDATED
SRSF4 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-361s1c1
Sequence:CCGGCCGCAGTAAGAGTAAAGACCACTCGAGTGGTCTTTACTCTTACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-349s1c1
Sequence:CCGGCCCTGACAAGAGCCGCAGTAACTCGAGTTACTGCGGCTCTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-785s1c1
Sequence:CCGGGTGTCAAAGGAGCGCGAACATCTCGAGATGTTCGCGCTCCTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-880s1c1
Sequence:CCGGCAGGTCAAGATCCACCTCCAACTCGAGTTGGAGGTGGATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-48s1c1
Sequence:CCGGGAACTGAAGTCAACGGCAGAACTCGAGTTCTGCCGTTGACTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-1347s21c1
Sequence:CCGGGTGTCAAAGGAGCGCGAACATCTCGAGATGTTCGCGCTCCTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-911s21c1
Sequence:CCGGCCCTGACAAGAGCCGCAGTAACTCGAGTTACTGCGGCTCTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-1442s21c1
Sequence:CCGGCAGGTCAAGATCCACCTCCAACTCGAGTTGGAGGTGGATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-610s21c1
Sequence:CCGGGAACTGAAGTCAACGGCAGAACTCGAGTTCTGCCGTTGACTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-923s21c1
Sequence:CCGGCCGCAGTAAGAGTAAAGACCACTCGAGTGGTCTTTACTCTTACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020587
VALIDATED
SRSF4 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-361s1c1
Sequence:CCGGCCGCAGTAAGAGTAAAGACCACTCGAGTGGTCTTTACTCTTACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-349s1c1
Sequence:CCGGCCCTGACAAGAGCCGCAGTAACTCGAGTTACTGCGGCTCTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-785s1c1
Sequence:CCGGGTGTCAAAGGAGCGCGAACATCTCGAGATGTTCGCGCTCCTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-880s1c1
Sequence:CCGGCAGGTCAAGATCCACCTCCAACTCGAGTTGGAGGTGGATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-48s1c1
Sequence:CCGGGAACTGAAGTCAACGGCAGAACTCGAGTTCTGCCGTTGACTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-1347s21c1
Sequence:CCGGGTGTCAAAGGAGCGCGAACATCTCGAGATGTTCGCGCTCCTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-911s21c1
Sequence:CCGGCCCTGACAAGAGCCGCAGTAACTCGAGTTACTGCGGCTCTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-1442s21c1
Sequence:CCGGCAGGTCAAGATCCACCTCCAACTCGAGTTGGAGGTGGATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-610s21c1
Sequence:CCGGGAACTGAAGTCAACGGCAGAACTCGAGTTCTGCCGTTGACTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-923s21c1
Sequence:CCGGCCGCAGTAAGAGTAAAGACCACTCGAGTGGTCTTTACTCTTACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020587
VALIDATED
SRSF4 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-361s1c1
Sequence:CCGGCCGCAGTAAGAGTAAAGACCACTCGAGTGGTCTTTACTCTTACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-349s1c1
Sequence:CCGGCCCTGACAAGAGCCGCAGTAACTCGAGTTACTGCGGCTCTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-785s1c1
Sequence:CCGGGTGTCAAAGGAGCGCGAACATCTCGAGATGTTCGCGCTCCTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-880s1c1
Sequence:CCGGCAGGTCAAGATCCACCTCCAACTCGAGTTGGAGGTGGATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020587.1-48s1c1
Sequence:CCGGGAACTGAAGTCAACGGCAGAACTCGAGTTCTGCCGTTGACTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-1347s21c1
Sequence:CCGGGTGTCAAAGGAGCGCGAACATCTCGAGATGTTCGCGCTCCTTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-911s21c1
Sequence:CCGGCCCTGACAAGAGCCGCAGTAACTCGAGTTACTGCGGCTCTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-1442s21c1
Sequence:CCGGCAGGTCAAGATCCACCTCCAACTCGAGTTGGAGGTGGATCTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-610s21c1
Sequence:CCGGGAACTGAAGTCAACGGCAGAACTCGAGTTCTGCCGTTGACTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020587.2-923s21c1
Sequence:CCGGCCGCAGTAAGAGTAAAGACCACTCGAGTGGTCTTTACTCTTACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005626
VALIDATED
SRSF4 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-1643s1c1
Sequence:CCGGGCACAAGTGATTGGAGTAGAACTCGAGTTCTACTCCAATCACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005626.3-735s1c1
Sequence:CCGGGCAGTCATTCTAAGAGTAGATCTCGAGATCTACTCTTAGAATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-1473s1c1
Sequence:CCGGGCTCCAGATCAAAGTCAGCTTCTCGAGAAGCTGACTTTGATCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-398s1c1
Sequence:CCGGCGCACAGAGTACAGACTTATTCTCGAGAATAAGTCTGTACTCTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005626.3-345s1c1
Sequence:CCGGGCAGTGGATATGGTTATAGAACTCGAGTTCTATAACCATATCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-342s21c1
Sequence:CCGGGACGCAGTGGATATGGTTATACTCGAGTATAACCATATCCACTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-275s21c1
Sequence:CCGGCTTTGTGGTGAGCGAGTAATTCTCGAGAATTACTCGCTCACCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-188s21c1
Sequence:CCGGGTGGATCTGAAGAACGGATATCTCGAGATATCCGTTCTTCAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-1691s21c1
Sequence:CCGGCCCTAATGGTGTGTCTATAATCTCGAGATTATAGACACACCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005626.3-449s21c1
Sequence:CCGGCAAGACCTAAAGGATTATATGCTCGAGCATATAATCCTTTAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005626
VALIDATED
SRSF4 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-1643s1c1
Sequence:CCGGGCACAAGTGATTGGAGTAGAACTCGAGTTCTACTCCAATCACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005626.3-735s1c1
Sequence:CCGGGCAGTCATTCTAAGAGTAGATCTCGAGATCTACTCTTAGAATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-1473s1c1
Sequence:CCGGGCTCCAGATCAAAGTCAGCTTCTCGAGAAGCTGACTTTGATCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-398s1c1
Sequence:CCGGCGCACAGAGTACAGACTTATTCTCGAGAATAAGTCTGTACTCTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005626.3-345s1c1
Sequence:CCGGGCAGTGGATATGGTTATAGAACTCGAGTTCTATAACCATATCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-342s21c1
Sequence:CCGGGACGCAGTGGATATGGTTATACTCGAGTATAACCATATCCACTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-275s21c1
Sequence:CCGGCTTTGTGGTGAGCGAGTAATTCTCGAGAATTACTCGCTCACCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-188s21c1
Sequence:CCGGGTGGATCTGAAGAACGGATATCTCGAGATATCCGTTCTTCAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-1691s21c1
Sequence:CCGGCCCTAATGGTGTGTCTATAATCTCGAGATTATAGACACACCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005626.3-449s21c1
Sequence:CCGGCAAGACCTAAAGGATTATATGCTCGAGCATATAATCCTTTAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005626
VALIDATED
SRSF4 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-1643s1c1
Sequence:CCGGGCACAAGTGATTGGAGTAGAACTCGAGTTCTACTCCAATCACTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005626.3-735s1c1
Sequence:CCGGGCAGTCATTCTAAGAGTAGATCTCGAGATCTACTCTTAGAATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-1473s1c1
Sequence:CCGGGCTCCAGATCAAAGTCAGCTTCTCGAGAAGCTGACTTTGATCTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005626.3-398s1c1
Sequence:CCGGCGCACAGAGTACAGACTTATTCTCGAGAATAAGTCTGTACTCTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005626.3-345s1c1
Sequence:CCGGGCAGTGGATATGGTTATAGAACTCGAGTTCTATAACCATATCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-342s21c1
Sequence:CCGGGACGCAGTGGATATGGTTATACTCGAGTATAACCATATCCACTGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-275s21c1
Sequence:CCGGCTTTGTGGTGAGCGAGTAATTCTCGAGAATTACTCGCTCACCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-188s21c1
Sequence:CCGGGTGGATCTGAAGAACGGATATCTCGAGATATCCGTTCTTCAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005626.3-1691s21c1
Sequence:CCGGCCCTAATGGTGTGTCTATAATCTCGAGATTATAGACACACCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005626.3-449s21c1
Sequence:CCGGCAAGACCTAAAGGATTATATGCTCGAGCATATAATCCTTTAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks