EMAIL THIS PAGE TO A FRIEND

SRSF5

serine/arginine-rich splicing factor 5

Synonyms: HRS SFRS5 SRP40
UniProtKB ID: Q13243, O14797, Q16662, Q49AD6, Q6FGE0
Gene ID:
Human(6430) Summary: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(20384) serine/arginine-rich splicing factor 5
Rat(29667) serine/arginine-rich splicing factor 5
chicken(423258) serine/arginine-rich splicing factor 5
Horse(100053264) serine/arginine-rich splicing factor 5
domestic cat(101101389) serine/arginine-rich splicing factor 5
dog(490754) serine/arginine-rich splicing factor 5
cow(510474) serine/arginine-rich splicing factor 5
sheep(101119990) serine/arginine-rich splicing factor 5
naked mole-rat(101703416) serine/arginine-rich splicing factor 5
domestic guinea pig(100723935) serine/arginine-rich splicing factor 5
227 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006925 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039465 Rosetta Predictions human pricing
NM_006925 Rosetta Predictions human pricing
NM_019257 Rosetta Predictions rat pricing
NM_001079694 Rosetta Predictions mouse pricing
NM_001079695 Rosetta Predictions mouse pricing
NM_009159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103981 predicted 603
2 SASI_Hs02_00308516 predicted 691
3 SASI_Hs01_00103982 predicted 467
4 SASI_Hs02_00308517 predicted 848
5 SASI_Hs01_00103984 predicted 467
6 SASI_Hs01_00103985 predicted 574
7 SASI_Hs01_00103986 predicted 532
8 SASI_Hs02_00308518 predicted 748
9 SASI_Hs01_00103987 predicted 562
10 SASI_Hs01_00103988 predicted 735
11 SASI_Hs01_00103983 predicted 481
12 SASI_Hs01_00103989 predicted 726
13 SASI_Hs01_00103990 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126364 predicted 472
2 SASI_Hs02_00342615 predicted 559
3 SASI_Hs01_00126365 predicted 340
4 SASI_Hs02_00342616 predicted 719
5 SASI_Hs01_00126367 predicted 329
6 SASI_Hs01_00126368 predicted 439
7 SASI_Hs01_00126369 predicted 395
8 SASI_Hs02_00342617 predicted 612
9 SASI_Hs01_00126370 predicted 428
10 SASI_Hs01_00126371 predicted 607
11 SASI_Hs01_00126366 predicted 342
12 SASI_Hs01_00126372 predicted 594
13 SASI_Hs01_00126373 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077387 predicted 451
2 SASI_Rn02_00262138 predicted 840
3 SASI_Rn01_00077390 predicted 373
4 SASI_Rn01_00077391 predicted 422
5 SASI_Rn02_00262139 predicted 918
6 SASI_Rn02_00262140 predicted 932
7 SASI_Rn02_00262141 predicted 1175
8 SASI_Rn02_00262142 predicted 565
9 SASI_Rn01_00077394 predicted 311
10 SASI_Rn01_00077395 predicted 411
11 SASI_Rn01_00077386 predicted 872
12 SASI_Rn01_00077388 predicted 746
13 SASI_Rn01_00077389 predicted 270
14 SASI_Rn01_00077392 predicted 1042
15 SASI_Rn01_00077393 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293032 predicted 512
2 SASI_Mm02_00293033 predicted 972
3 SASI_Mm02_00293034 predicted 433
4 SASI_Mm02_00293035 predicted 475
5 SASI_Mm02_00293036 predicted 598
6 SASI_Mm02_00293037 predicted 1221
7 SASI_Mm02_00293038 predicted 466
8 SASI_Mm02_00293039 predicted 465
9 SASI_Mm02_00293040 predicted 1205
10 SASI_Mm02_00293041 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293042 predicted 631
2 SASI_Mm02_00293043 predicted 1103
3 SASI_Mm02_00293044 predicted 552
4 SASI_Mm02_00293045 predicted 604
5 SASI_Mm02_00293046 predicted 726
6 SASI_Mm02_00293047 predicted 1350
7 SASI_Mm02_00293048 predicted 587
8 SASI_Mm02_00293049 predicted 591
9 SASI_Mm02_00293050 predicted 1334
10 SASI_Mm02_00293051 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315490 predicted 501
2 SASI_Mm02_00315491 predicted 969
3 SASI_Mm02_00315492 predicted 422
4 SASI_Mm02_00315493 predicted 472
5 SASI_Mm02_00315494 predicted 589
6 SASI_Mm02_00315495 predicted 1218
7 SASI_Mm02_00315496 predicted 463
8 SASI_Mm02_00315497 predicted 462
9 SASI_Mm02_00315498 predicted 1203
10 SASI_Mm02_00315499 predicted 647
11 SASI_Mm01_00081579 predicted 297
12 SASI_Mm01_00081580 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009159
VALIDATED
SRSF5 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 5
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-797s21c1
Sequence:CCGGTCACGAAGGAGCAAGTCTTACCTCGAGGTAAGACTTGCTCCTTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-328s21c1
Sequence:CCGGGGATGCAGATGATGCTGTTTACTCGAGTAAACAGCATCATCTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-262s21c1
Sequence:CCGGTTACGGACGGATCCGAGATATCTCGAGATATCTCGGATCCGTCCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1206s21c1
Sequence:CCGGTGTGACTGTCTGAAGTATATACTCGAGTATATACTTCAGACAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1044s21c1
Sequence:CCGGTCCCAAACCATACTTGCTAAACTCGAGTTTAGCAAGTATGGTTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-626s21c1
Sequence:CCGCGTAGTTGAGTTTGCCTCTTATCTCGAGATAAGAGGCAAACTCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-509s21c1
Sequence:CCGGCGACTTATAGTTGAGAATTTACTCGAGTAAATTCTCAACTATAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-648s21c1
Sequence:CCGGGTGACTTAAAGAATGCTATTGCTCGAGCAATAGCATTCTTTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1376s21c1
Sequence:CCGGAGCTCTAAATTTGCTTGTATACTCGAGTATACAAGCAAATTTAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-382s1c1
Sequence:CCGGGCAGGATCTCAAAGATTTCATCTCGAGATGAAATCTTTGAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-885s1c1
Sequence:CCGGCCCAAACCATAACTTGCTAAACTCGAGTTTAGCAAGTTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-298s1c1
Sequence:CCGGCCTCGGAAATGATAGACGAAACTCGAGTTTCGTCTATCATTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-437s1c1
Sequence:CCGGCATCGACCTAAACTAAATGAACTCGAGTTCATTTAGTTTAGGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009159
VALIDATED
SRSF5 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 5
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-797s21c1
Sequence:CCGGTCACGAAGGAGCAAGTCTTACCTCGAGGTAAGACTTGCTCCTTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-328s21c1
Sequence:CCGGGGATGCAGATGATGCTGTTTACTCGAGTAAACAGCATCATCTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-262s21c1
Sequence:CCGGTTACGGACGGATCCGAGATATCTCGAGATATCTCGGATCCGTCCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1206s21c1
Sequence:CCGGTGTGACTGTCTGAAGTATATACTCGAGTATATACTTCAGACAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1044s21c1
Sequence:CCGGTCCCAAACCATACTTGCTAAACTCGAGTTTAGCAAGTATGGTTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-626s21c1
Sequence:CCGCGTAGTTGAGTTTGCCTCTTATCTCGAGATAAGAGGCAAACTCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-509s21c1
Sequence:CCGGCGACTTATAGTTGAGAATTTACTCGAGTAAATTCTCAACTATAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-648s21c1
Sequence:CCGGGTGACTTAAAGAATGCTATTGCTCGAGCAATAGCATTCTTTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1376s21c1
Sequence:CCGGAGCTCTAAATTTGCTTGTATACTCGAGTATACAAGCAAATTTAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-382s1c1
Sequence:CCGGGCAGGATCTCAAAGATTTCATCTCGAGATGAAATCTTTGAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-885s1c1
Sequence:CCGGCCCAAACCATAACTTGCTAAACTCGAGTTTAGCAAGTTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-298s1c1
Sequence:CCGGCCTCGGAAATGATAGACGAAACTCGAGTTTCGTCTATCATTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-437s1c1
Sequence:CCGGCATCGACCTAAACTAAATGAACTCGAGTTCATTTAGTTTAGGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009159
VALIDATED
SRSF5 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 5
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-797s21c1
Sequence:CCGGTCACGAAGGAGCAAGTCTTACCTCGAGGTAAGACTTGCTCCTTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-328s21c1
Sequence:CCGGGGATGCAGATGATGCTGTTTACTCGAGTAAACAGCATCATCTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-262s21c1
Sequence:CCGGTTACGGACGGATCCGAGATATCTCGAGATATCTCGGATCCGTCCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1206s21c1
Sequence:CCGGTGTGACTGTCTGAAGTATATACTCGAGTATATACTTCAGACAGTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1044s21c1
Sequence:CCGGTCCCAAACCATACTTGCTAAACTCGAGTTTAGCAAGTATGGTTTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-626s21c1
Sequence:CCGCGTAGTTGAGTTTGCCTCTTATCTCGAGATAAGAGGCAAACTCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-509s21c1
Sequence:CCGGCGACTTATAGTTGAGAATTTACTCGAGTAAATTCTCAACTATAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009159.2-648s21c1
Sequence:CCGGGTGACTTAAAGAATGCTATTGCTCGAGCAATAGCATTCTTTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009159.2-1376s21c1
Sequence:CCGGAGCTCTAAATTTGCTTGTATACTCGAGTATACAAGCAAATTTAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-382s1c1
Sequence:CCGGGCAGGATCTCAAAGATTTCATCTCGAGATGAAATCTTTGAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-885s1c1
Sequence:CCGGCCCAAACCATAACTTGCTAAACTCGAGTTTAGCAAGTTATGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-298s1c1
Sequence:CCGGCCTCGGAAATGATAGACGAAACTCGAGTTTCGTCTATCATTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009159.1-437s1c1
Sequence:CCGGCATCGACCTAAACTAAATGAACTCGAGTTCATTTAGTTTAGGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006925
VALIDATED
SRSF5 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-954s21c1
Sequence:CCGGCAGTTGACAGTGGCAATTAAACTCGAGTTTAATTGCCACTGTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006925.3-1177s21c1
Sequence:CCGGATAAGCCTTCTGCTCACATTTCTCGAGAAATGTGAGCAGAAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-388s21c1
Sequence:CCGGTGGAAGAGGTAGAGGACGATACTCGAGTATCGTCCTCTACCTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-564s21c1
Sequence:CCGGCGGATGCACACCGACCTAAATCTCGAGATTTAGGTCGGTGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006925.3-422s21c1
Sequence:CCGGAGTAGTCGCAGACCTCGAAATCTCGAGATTTCGAGGTCTGCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-562s1c1
Sequence:CCGGCATTTAAGATTCAGGAGTCATCTCGAGATGACTCCTGAATCTTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-452s1c1
Sequence:CCGGTGGAAGAGGTAGAGGACGATACTCGAGTATCGTCCTCTACCTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-376s1c1
Sequence:CCGGCTGTGTATGAGCTTGATGGAACTCGAGTTCCATCAAGCTCATACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-510s1c1
Sequence:CCGGAGACGGTATGTGAAGGGTGGACTCGAGTCCACCCTTCACATACCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006925.x-511s1c1
Sequence:CCGGGACGGTATGTGAAGGGTGGATCTCGAGATCCACCCTTCACATACCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006925
VALIDATED
SRSF5 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-954s21c1
Sequence:CCGGCAGTTGACAGTGGCAATTAAACTCGAGTTTAATTGCCACTGTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006925.3-1177s21c1
Sequence:CCGGATAAGCCTTCTGCTCACATTTCTCGAGAAATGTGAGCAGAAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-388s21c1
Sequence:CCGGTGGAAGAGGTAGAGGACGATACTCGAGTATCGTCCTCTACCTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-564s21c1
Sequence:CCGGCGGATGCACACCGACCTAAATCTCGAGATTTAGGTCGGTGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006925.3-422s21c1
Sequence:CCGGAGTAGTCGCAGACCTCGAAATCTCGAGATTTCGAGGTCTGCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-562s1c1
Sequence:CCGGCATTTAAGATTCAGGAGTCATCTCGAGATGACTCCTGAATCTTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-452s1c1
Sequence:CCGGTGGAAGAGGTAGAGGACGATACTCGAGTATCGTCCTCTACCTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-376s1c1
Sequence:CCGGCTGTGTATGAGCTTGATGGAACTCGAGTTCCATCAAGCTCATACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-510s1c1
Sequence:CCGGAGACGGTATGTGAAGGGTGGACTCGAGTCCACCCTTCACATACCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006925.x-511s1c1
Sequence:CCGGGACGGTATGTGAAGGGTGGATCTCGAGATCCACCCTTCACATACCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006925
VALIDATED
SRSF5 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-954s21c1
Sequence:CCGGCAGTTGACAGTGGCAATTAAACTCGAGTTTAATTGCCACTGTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006925.3-1177s21c1
Sequence:CCGGATAAGCCTTCTGCTCACATTTCTCGAGAAATGTGAGCAGAAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-388s21c1
Sequence:CCGGTGGAAGAGGTAGAGGACGATACTCGAGTATCGTCCTCTACCTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006925.3-564s21c1
Sequence:CCGGCGGATGCACACCGACCTAAATCTCGAGATTTAGGTCGGTGTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006925.3-422s21c1
Sequence:CCGGAGTAGTCGCAGACCTCGAAATCTCGAGATTTCGAGGTCTGCGACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-562s1c1
Sequence:CCGGCATTTAAGATTCAGGAGTCATCTCGAGATGACTCCTGAATCTTAAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-452s1c1
Sequence:CCGGTGGAAGAGGTAGAGGACGATACTCGAGTATCGTCCTCTACCTCTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-376s1c1
Sequence:CCGGCTGTGTATGAGCTTGATGGAACTCGAGTTCCATCAAGCTCATACACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006925.x-510s1c1
Sequence:CCGGAGACGGTATGTGAAGGGTGGACTCGAGTCCACCCTTCACATACCGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006925.x-511s1c1
Sequence:CCGGGACGGTATGTGAAGGGTGGATCTCGAGATCCACCCTTCACATACCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks