EMAIL THIS PAGE TO A FRIEND

SRSF6

serine/arginine-rich splicing factor 6

Synonyms: B52 SFRS6 SRP55
Gene ID:
Human(6431) Summary: The protein encoded by this gene is involved in mRNA splicing and may play a role in the determination of alternative splicing. The encoded nuclear protein belongs to the splicing factor SR family and has been shown to bind with and modulate another member of the family, SFRS12. Alternative splicing results in multiple transcript variants. In addition, two pseudogenes, one on chromosome 17 and the other on the X chromosome, have been found for this gene.[provided by RefSeq, Sep 2010]
Mouse(67996) serine/arginine-rich splicing factor 6
Rat(362264) serine/arginine-rich splicing factor 6
chicken(419116) serine/arginine-rich splicing factor 6
domestic cat(101091686) serine/arginine-rich splicing factor 6
Horse(100070669) serine/arginine-rich splicing factor 6
dog(403667) serine/arginine-rich splicing factor 6
domestic guinea pig(100734987) serine/arginine-rich splicing factor 6
naked mole-rat(101719303) serine/arginine-rich splicing factor 6
cow(507828) serine/arginine-rich splicing factor 6
sheep(101106704) serine/arginine-rich splicing factor 6
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006275 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006275 Rosetta Predictions human pricing
NM_001014185 Rosetta Predictions rat pricing
NM_026499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341239 predicted 1235
2 SASI_Hs02_00341240 predicted 1129
3 SASI_Hs02_00341241 predicted 435
4 SASI_Hs02_00341242 predicted 586
5 SASI_Hs02_00341243 predicted 716
6 SASI_Hs02_00341244 predicted 1232
7 SASI_Hs02_00341245 predicted 1134
8 SASI_Hs02_00341246 predicted 585
9 SASI_Hs02_00341247 predicted 597
10 SASI_Hs02_00341248 predicted 669
11 SASI_Hs01_00186103 predicted 1205
12 SASI_Hs01_00186104 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053839 predicted 1123
2 SASI_Rn01_00053840 predicted 848
3 SASI_Rn01_00053841 predicted 1113
4 SASI_Rn01_00053842 predicted 901
5 SASI_Rn01_00053843 predicted 784
6 SASI_Rn01_00053844 predicted 635
7 SASI_Rn01_00053845 predicted 648
8 SASI_Rn01_00053846 predicted 546
9 SASI_Rn01_00053847 predicted 559
10 SASI_Rn01_00053848 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075653 predicted 1158
2 SASI_Mm02_00330391 predicted 1117
3 SASI_Mm02_00330392 predicted 597
4 SASI_Mm01_00075654 predicted 914
5 SASI_Mm01_00075655 predicted 1099
6 SASI_Mm01_00075656 predicted 794
7 SASI_Mm01_00075657 predicted 653
8 SASI_Mm01_00075658 predicted 1186
9 SASI_Mm01_00075659 predicted 641
10 SASI_Mm01_00075660 predicted 933
11 SASI_Mm01_00075661 predicted 927
12 SASI_Mm01_00075662 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026499
SRSF6 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026499.2-1251s1c1
Sequence:CCGGCGCCTCTTCTTTAAGAGGATTCTCGAGAATCCTCTTAAAGAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-1148s1c1
Sequence:CCGGCCAGATCAAGTTCCAGAGATTCTCGAGAATCTCTGGAACTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-583s1c1
Sequence:CCGGCGAACAAATGAGGGTGTGATTCTCGAGAATCACACCCTCATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-469s1c1
Sequence:CCGGCGTACAGAGTACAGGCTTATTCTCGAGAATAAGCCTGTACTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-571s1c1
Sequence:CCGGGCTCACAAAGAACGAACAAATCTCGAGATTTGTTCGTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026499
SRSF6 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026499.2-1251s1c1
Sequence:CCGGCGCCTCTTCTTTAAGAGGATTCTCGAGAATCCTCTTAAAGAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-1148s1c1
Sequence:CCGGCCAGATCAAGTTCCAGAGATTCTCGAGAATCTCTGGAACTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-583s1c1
Sequence:CCGGCGAACAAATGAGGGTGTGATTCTCGAGAATCACACCCTCATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-469s1c1
Sequence:CCGGCGTACAGAGTACAGGCTTATTCTCGAGAATAAGCCTGTACTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-571s1c1
Sequence:CCGGGCTCACAAAGAACGAACAAATCTCGAGATTTGTTCGTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026499
SRSF6 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026499.2-1251s1c1
Sequence:CCGGCGCCTCTTCTTTAAGAGGATTCTCGAGAATCCTCTTAAAGAAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-1148s1c1
Sequence:CCGGCCAGATCAAGTTCCAGAGATTCTCGAGAATCTCTGGAACTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-583s1c1
Sequence:CCGGCGAACAAATGAGGGTGTGATTCTCGAGAATCACACCCTCATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-469s1c1
Sequence:CCGGCGTACAGAGTACAGGCTTATTCTCGAGAATAAGCCTGTACTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026499.2-571s1c1
Sequence:CCGGGCTCACAAAGAACGAACAAATCTCGAGATTTGTTCGTTCTTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006275
VALIDATED
SRSF6 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006275.4-1856s1c1
Sequence:CCGGCCCTTTAACAAGTTGAGTAAACTCGAGTTTACTCAACTTGTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-659s1c1
Sequence:CCGGGCACAGAAATAAATGGCAGAACTCGAGTTCTGCCATTTATTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-475s1c1
Sequence:CCGGCGTACAGAATACAGGCTTATTCTCGAGAATAAGCCTGTATTCTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-923s1c1
Sequence:CCGGGCTCCCATTCACATTCTCGAACTCGAGTTCGAGAATGTGAATGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-1134s1c1
Sequence:CCGGCCGTTCTAGATCTCGCTCAAACTCGAGTTTGAGCGAGATCTAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-513s21c1
Sequence:CCGGTCGGTGCAGTTGGCAAGATTTCTCGAGAAATCTTGCCAACTGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006275.4-589s21c1
Sequence:CCGGCGAACAAATGAGGGTGTAATTCTCGAGAATTACACCCTCATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-673s21c1
Sequence:CCGGGGCAGAAATATTAGGCTTATTCTCGAGAATAAGCCTAATATTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006275.4-3321s21c1
Sequence:CCGGGTAATAGCCACGACCAATTTACTCGAGTAAATTGGTCGTGGCTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-793s21c1
Sequence:CCGGCGCAGTAGATCTCGAAGTATCCTCGAGGATACTTCGAGATCTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006275
VALIDATED
SRSF6 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006275.4-1856s1c1
Sequence:CCGGCCCTTTAACAAGTTGAGTAAACTCGAGTTTACTCAACTTGTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-659s1c1
Sequence:CCGGGCACAGAAATAAATGGCAGAACTCGAGTTCTGCCATTTATTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-475s1c1
Sequence:CCGGCGTACAGAATACAGGCTTATTCTCGAGAATAAGCCTGTATTCTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-923s1c1
Sequence:CCGGGCTCCCATTCACATTCTCGAACTCGAGTTCGAGAATGTGAATGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-1134s1c1
Sequence:CCGGCCGTTCTAGATCTCGCTCAAACTCGAGTTTGAGCGAGATCTAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-513s21c1
Sequence:CCGGTCGGTGCAGTTGGCAAGATTTCTCGAGAAATCTTGCCAACTGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006275.4-589s21c1
Sequence:CCGGCGAACAAATGAGGGTGTAATTCTCGAGAATTACACCCTCATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-673s21c1
Sequence:CCGGGGCAGAAATATTAGGCTTATTCTCGAGAATAAGCCTAATATTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006275.4-3321s21c1
Sequence:CCGGGTAATAGCCACGACCAATTTACTCGAGTAAATTGGTCGTGGCTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-793s21c1
Sequence:CCGGCGCAGTAGATCTCGAAGTATCCTCGAGGATACTTCGAGATCTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006275
VALIDATED
SRSF6 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006275.4-1856s1c1
Sequence:CCGGCCCTTTAACAAGTTGAGTAAACTCGAGTTTACTCAACTTGTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-659s1c1
Sequence:CCGGGCACAGAAATAAATGGCAGAACTCGAGTTCTGCCATTTATTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-475s1c1
Sequence:CCGGCGTACAGAATACAGGCTTATTCTCGAGAATAAGCCTGTATTCTGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-923s1c1
Sequence:CCGGGCTCCCATTCACATTCTCGAACTCGAGTTCGAGAATGTGAATGGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006275.4-1134s1c1
Sequence:CCGGCCGTTCTAGATCTCGCTCAAACTCGAGTTTGAGCGAGATCTAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-513s21c1
Sequence:CCGGTCGGTGCAGTTGGCAAGATTTCTCGAGAAATCTTGCCAACTGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006275.4-589s21c1
Sequence:CCGGCGAACAAATGAGGGTGTAATTCTCGAGAATTACACCCTCATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-673s21c1
Sequence:CCGGGGCAGAAATATTAGGCTTATTCTCGAGAATAAGCCTAATATTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006275.4-3321s21c1
Sequence:CCGGGTAATAGCCACGACCAATTTACTCGAGTAAATTGGTCGTGGCTATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006275.4-793s21c1
Sequence:CCGGCGCAGTAGATCTCGAAGTATCCTCGAGGATACTTCGAGATCTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks