EMAIL THIS PAGE TO A FRIEND

SRSF7

serine/arginine-rich splicing factor 7

Synonyms: 9G8 AAG3 SFRS7
UniProtKB ID: Q16629, B4DLU6, G5E9M3, Q564D3
Gene ID:
Human(6432) Summary: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(225027) serine/arginine-rich splicing factor 7
Rat(362687) serine/arginine-rich splicing factor 7
chicken(426265) serine/arginine-rich splicing factor 7
domestic cat(101096561) serine/arginine-rich splicing factor 7
Horse(100054033) serine/arginine-rich splicing factor 7
dog(475730) serine/arginine-rich splicing factor 7
cow(507066) serine/arginine-rich splicing factor 7
sheep(101118771) serine/arginine-rich splicing factor 7
naked mole-rat(101704042) serine/arginine-rich splicing factor 7
domestic guinea pig(100714040) serine/arginine-rich splicing factor 7
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001031684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031684 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_006276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006276 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031684 Rosetta Predictions human pricing
NM_001039035 Rosetta Predictions rat pricing
NM_146083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094911 predicted 441
2 SASI_Hs01_00094912 predicted 819
3 SASI_Hs01_00094913 predicted 416
4 SASI_Hs01_00094914 predicted 631
5 SASI_Hs01_00094915 predicted 251
6 SASI_Hs01_00094916 predicted 199
7 SASI_Hs01_00094917 predicted 712
8 SASI_Hs01_00094918 predicted 455
9 SASI_Hs01_00094919 predicted 492
10 SASI_Hs01_00094920 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098852 predicted 642
2 SASI_Rn01_00098853 predicted 490
3 SASI_Rn02_00204789 predicted 796
4 SASI_Rn01_00098854 predicted 730
5 SASI_Rn02_00204790 predicted 453
6 SASI_Rn01_00098855 predicted 712
7 SASI_Rn01_00098856 predicted 550
8 SASI_Rn01_00098857 predicted 484
9 SASI_Rn01_00098858 predicted 847
10 SASI_Rn01_00098859 predicted 642
11 SASI_Rn01_00098860 predicted 468
12 SASI_Rn01_00098861 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138329 predicted 813
2 SASI_Mm01_00138330 predicted 446
3 SASI_Mm01_00138331 predicted 435
4 SASI_Mm01_00138332 predicted 705
5 SASI_Mm01_00138333 predicted 390
6 SASI_Mm01_00138334 predicted 398
7 SASI_Mm01_00138335 predicted 434
8 SASI_Mm02_00341718 predicted 863
9 SASI_Mm01_00138336 predicted 708
10 SASI_Mm01_00138337 predicted 286
11 SASI_Mm01_00138338 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146083
VALIDATED
SRSF7 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-284s21c1
Sequence:CCGGGTTCGAGGATTGGATGGGAAACTCGAGTTTCCCATCCAATCCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-588s21c1
Sequence:CCGGCTGTGTCTCTTCGTAGATCAACTCGAGTTGATCTACGAAGAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-159s21c1
Sequence:CCGGCTGGTAAAGGAGAGTTAGAAACTCGAGTTTCTAACTCTCCTTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-383s21c1
Sequence:CCGGCGTCGTCCCTTTGATCCTAATCTCGAGATTAGGATCAAAGGGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-383s1c1
Sequence:CCGGCGTCGTCCCTTTGATCCTAATCTCGAGATTAGGATCAAAGGGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146083.1-440s1c1
Sequence:CCGGGCTTATGACTGTCATCGCTATCTCGAGATAGCGATGACAGTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-284s1c1
Sequence:CCGGGTTCGAGGATTGGATGGGAAACTCGAGTTTCCCATCCAATCCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-159s1c1
Sequence:CCGGCTGGTAAAGGAGAGTTAGAAACTCGAGTTTCTAACTCTCCTTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-588s1c1
Sequence:CCGGCTGTGTCTCTTCGTAGATCAACTCGAGTTGATCTACGAAGAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146083
VALIDATED
SRSF7 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-284s21c1
Sequence:CCGGGTTCGAGGATTGGATGGGAAACTCGAGTTTCCCATCCAATCCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-588s21c1
Sequence:CCGGCTGTGTCTCTTCGTAGATCAACTCGAGTTGATCTACGAAGAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-159s21c1
Sequence:CCGGCTGGTAAAGGAGAGTTAGAAACTCGAGTTTCTAACTCTCCTTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-383s21c1
Sequence:CCGGCGTCGTCCCTTTGATCCTAATCTCGAGATTAGGATCAAAGGGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-383s1c1
Sequence:CCGGCGTCGTCCCTTTGATCCTAATCTCGAGATTAGGATCAAAGGGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146083.1-440s1c1
Sequence:CCGGGCTTATGACTGTCATCGCTATCTCGAGATAGCGATGACAGTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-284s1c1
Sequence:CCGGGTTCGAGGATTGGATGGGAAACTCGAGTTTCCCATCCAATCCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-159s1c1
Sequence:CCGGCTGGTAAAGGAGAGTTAGAAACTCGAGTTTCTAACTCTCCTTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-588s1c1
Sequence:CCGGCTGTGTCTCTTCGTAGATCAACTCGAGTTGATCTACGAAGAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146083
VALIDATED
SRSF7 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-284s21c1
Sequence:CCGGGTTCGAGGATTGGATGGGAAACTCGAGTTTCCCATCCAATCCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-588s21c1
Sequence:CCGGCTGTGTCTCTTCGTAGATCAACTCGAGTTGATCTACGAAGAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-159s21c1
Sequence:CCGGCTGGTAAAGGAGAGTTAGAAACTCGAGTTTCTAACTCTCCTTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146083.1-383s21c1
Sequence:CCGGCGTCGTCCCTTTGATCCTAATCTCGAGATTAGGATCAAAGGGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-383s1c1
Sequence:CCGGCGTCGTCCCTTTGATCCTAATCTCGAGATTAGGATCAAAGGGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146083.1-440s1c1
Sequence:CCGGGCTTATGACTGTCATCGCTATCTCGAGATAGCGATGACAGTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-284s1c1
Sequence:CCGGGTTCGAGGATTGGATGGGAAACTCGAGTTTCCCATCCAATCCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-159s1c1
Sequence:CCGGCTGGTAAAGGAGAGTTAGAAACTCGAGTTTCTAACTCTCCTTTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146083.1-588s1c1
Sequence:CCGGCTGTGTCTCTTCGTAGATCAACTCGAGTTGATCTACGAAGAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031684
VALIDATED
SRSF7 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031684.2-1445s21c1
Sequence:CCGGAGATCCTTAAGTTAGCTAATCCTCGAGGATTAGCTAACTTAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031684.2-625s21c1
Sequence:CCGGGTCACGGTCTAGATCACATTCCTCGAGGAATGTGATCTAGACCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031684.2-828s21c1
Sequence:CCGGGATCAAGATCCAGGTCTATTTCTCGAGAAATAGACCTGGATCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031684.2-716s21c1
Sequence:CCGGCCTCGACGATCAAGATCTATCCTCGAGGATAGATCTTGATCGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031684.2-351s21c1
Sequence:CCGGGAACTGTATGGATTGCGAGAACTCGAGTTCTCGCAATCCATACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031684
VALIDATED
SRSF7 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031684.2-1445s21c1
Sequence:CCGGAGATCCTTAAGTTAGCTAATCCTCGAGGATTAGCTAACTTAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031684.2-625s21c1
Sequence:CCGGGTCACGGTCTAGATCACATTCCTCGAGGAATGTGATCTAGACCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031684.2-828s21c1
Sequence:CCGGGATCAAGATCCAGGTCTATTTCTCGAGAAATAGACCTGGATCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031684.2-716s21c1
Sequence:CCGGCCTCGACGATCAAGATCTATCCTCGAGGATAGATCTTGATCGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031684.2-351s21c1
Sequence:CCGGGAACTGTATGGATTGCGAGAACTCGAGTTCTCGCAATCCATACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031684
VALIDATED
SRSF7 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031684.2-1445s21c1
Sequence:CCGGAGATCCTTAAGTTAGCTAATCCTCGAGGATTAGCTAACTTAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031684.2-625s21c1
Sequence:CCGGGTCACGGTCTAGATCACATTCCTCGAGGAATGTGATCTAGACCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031684.2-828s21c1
Sequence:CCGGGATCAAGATCCAGGTCTATTTCTCGAGAAATAGACCTGGATCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031684.2-716s21c1
Sequence:CCGGCCTCGACGATCAAGATCTATCCTCGAGGATAGATCTTGATCGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001031684.2-351s21c1
Sequence:CCGGGAACTGTATGGATTGCGAGAACTCGAGTTCTCGCAATCCATACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006276
VALIDATED
SRSF7 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006276.x-2572s1c1
Sequence:CCGGCGCTAGTATGTTGGAAGTTATCTCGAGATAACTTCCAACATACTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-367s1c1
Sequence:CCGGGATGCTATGAGTGTGGCGAAACTCGAGTTTCGCCACACTCATAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-248s1c1
Sequence:CCGGAGGACTGGATGGAAAGGTGATCTCGAGATCACCTTTCCATCCAGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-435s1c1
Sequence:CCGGAGCAGGTTTCTTCGTTTGAGTCTCGAGACTCAAACGAAGAAACCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006276.x-166s1c1
Sequence:CCGGGAACTGTATGGATTGCGAGAACTCGAGTTCTCGCAATCCATACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006276
VALIDATED
SRSF7 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006276.x-2572s1c1
Sequence:CCGGCGCTAGTATGTTGGAAGTTATCTCGAGATAACTTCCAACATACTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-367s1c1
Sequence:CCGGGATGCTATGAGTGTGGCGAAACTCGAGTTTCGCCACACTCATAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-248s1c1
Sequence:CCGGAGGACTGGATGGAAAGGTGATCTCGAGATCACCTTTCCATCCAGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-435s1c1
Sequence:CCGGAGCAGGTTTCTTCGTTTGAGTCTCGAGACTCAAACGAAGAAACCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006276.x-166s1c1
Sequence:CCGGGAACTGTATGGATTGCGAGAACTCGAGTTCTCGCAATCCATACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006276
VALIDATED
SRSF7 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006276.x-2572s1c1
Sequence:CCGGCGCTAGTATGTTGGAAGTTATCTCGAGATAACTTCCAACATACTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-367s1c1
Sequence:CCGGGATGCTATGAGTGTGGCGAAACTCGAGTTTCGCCACACTCATAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-248s1c1
Sequence:CCGGAGGACTGGATGGAAAGGTGATCTCGAGATCACCTTTCCATCCAGTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006276.x-435s1c1
Sequence:CCGGAGCAGGTTTCTTCGTTTGAGTCTCGAGACTCAAACGAAGAAACCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006276.x-166s1c1
Sequence:CCGGGAACTGTATGGATTGCGAGAACTCGAGTTCTCGCAATCCATACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks