EMAIL THIS PAGE TO A FRIEND

SRSF8

serine/arginine-rich splicing factor 8

Synonyms: DSM-1 SFRS2B SRP46
Species: Human SRSF8(10929)
UniProtKB ID: Q9BRL6, B2R6B8, Q6PF01, Q96TA3
Gene ID:
Human(10929) Summary: This gene encodes a member of a family of proteins containing a ribonucleoprotein (RNP)-type RNA binding motif and a carboxyl-terminal arginine-serine-rich (RS) domain. The encoded protein functions as a pre-mRNA splicing factor. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032102 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU217661 MISSION® esiRNA esiRNA targeting human SRSF8 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032102 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155510 predicted 1263
2 SASI_Hs01_00155511 predicted 1616
3 SASI_Hs01_00155512 predicted 1388
4 SASI_Hs01_00155514 predicted 893
5 SASI_Hs02_00359285 predicted 1195
6 SASI_Hs02_00359286 predicted 1622
7 SASI_Hs01_00155515 predicted 1230
8 SASI_Hs02_00359287 predicted 854
9 SASI_Hs01_00155516 predicted 822
10 SASI_Hs02_00359288 predicted 1475
11 SASI_Hs01_00155509 predicted 1280
12 SASI_Hs01_00155513 predicted 1113
13 SASI_Hs01_00155517 predicted 868
14 SASI_Hs01_00155518 predicted 1521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032102
VALIDATED
SRSF8 MISSION shRNA Bacterial Glycerol Stock
serine/arginine-rich splicing factor 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-1935s1c1
Sequence:CCGGGCTGACGATAATCACACCTTTCTCGAGAAAGGTGTGATTATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-926s1c1
Sequence:CCGGCCACTAGCTCTCGCTCTGCATCTCGAGATGCAGAGCGAGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-861s1c1
Sequence:CCGGTGGTTACAGTAACTCTCGCTACTCGAGTAGCGAGAGTTACTGTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-1043s1c1
Sequence:CCGGCCCGGGTATCCAAGAGGAAATCTCGAGATTTCCTCTTGGATACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-852s1c1
Sequence:CCGGCAGCTCATCTGGTTACAGTAACTCGAGTTACTGTAACCAGATGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032102.2-941s21c1
Sequence:CCGGATATCACAGCAGCCGGTCTCACTCGAGTGAGACCGGCTGCTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1167s21c1
Sequence:CCGGGGACAGATGTCCTCTTAAGAACTCGAGTTCTTAAGAGGACATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-979s21c1
Sequence:CCGGCCACTAGCTCTCGCTCTGCATCTCGAGATGCAGAGCGAGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1988s21c1
Sequence:CCGGGCTGACGATAATCACACCTTTCTCGAGAAAGGTGTGATTATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1062s21c1
Sequence:CCGGCGGTCCAGGTCTTCATCTATGCTCGAGCATAGATGAAGACCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032102
VALIDATED
SRSF8 MISSION shRNA shRNA Plasmid DNA
serine/arginine-rich splicing factor 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-1935s1c1
Sequence:CCGGGCTGACGATAATCACACCTTTCTCGAGAAAGGTGTGATTATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-926s1c1
Sequence:CCGGCCACTAGCTCTCGCTCTGCATCTCGAGATGCAGAGCGAGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-861s1c1
Sequence:CCGGTGGTTACAGTAACTCTCGCTACTCGAGTAGCGAGAGTTACTGTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-1043s1c1
Sequence:CCGGCCCGGGTATCCAAGAGGAAATCTCGAGATTTCCTCTTGGATACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-852s1c1
Sequence:CCGGCAGCTCATCTGGTTACAGTAACTCGAGTTACTGTAACCAGATGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032102.2-941s21c1
Sequence:CCGGATATCACAGCAGCCGGTCTCACTCGAGTGAGACCGGCTGCTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1167s21c1
Sequence:CCGGGGACAGATGTCCTCTTAAGAACTCGAGTTCTTAAGAGGACATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-979s21c1
Sequence:CCGGCCACTAGCTCTCGCTCTGCATCTCGAGATGCAGAGCGAGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1988s21c1
Sequence:CCGGGCTGACGATAATCACACCTTTCTCGAGAAAGGTGTGATTATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1062s21c1
Sequence:CCGGCGGTCCAGGTCTTCATCTATGCTCGAGCATAGATGAAGACCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032102
VALIDATED
SRSF8 MISSION shRNA Lentiviral Transduction Particles
serine/arginine-rich splicing factor 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-1935s1c1
Sequence:CCGGGCTGACGATAATCACACCTTTCTCGAGAAAGGTGTGATTATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-926s1c1
Sequence:CCGGCCACTAGCTCTCGCTCTGCATCTCGAGATGCAGAGCGAGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-861s1c1
Sequence:CCGGTGGTTACAGTAACTCTCGCTACTCGAGTAGCGAGAGTTACTGTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-1043s1c1
Sequence:CCGGCCCGGGTATCCAAGAGGAAATCTCGAGATTTCCTCTTGGATACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032102.1-852s1c1
Sequence:CCGGCAGCTCATCTGGTTACAGTAACTCGAGTTACTGTAACCAGATGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032102.2-941s21c1
Sequence:CCGGATATCACAGCAGCCGGTCTCACTCGAGTGAGACCGGCTGCTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1167s21c1
Sequence:CCGGGGACAGATGTCCTCTTAAGAACTCGAGTTCTTAAGAGGACATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-979s21c1
Sequence:CCGGCCACTAGCTCTCGCTCTGCATCTCGAGATGCAGAGCGAGAGCTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1988s21c1
Sequence:CCGGGCTGACGATAATCACACCTTTCTCGAGAAAGGTGTGATTATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_032102.2-1062s21c1
Sequence:CCGGCGGTCCAGGTCTTCATCTATGCTCGAGCATAGATGAAGACCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks